ID: 1085731382

View in Genome Browser
Species Human (GRCh38)
Location 11:79001989-79002011
Sequence CTGCTTTTCTGGTGCATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085731368_1085731382 29 Left 1085731368 11:79001937-79001959 CCTCCCTCCACTGTTTTGCTGTC 0: 1
1: 0
2: 2
3: 29
4: 366
Right 1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1085731370_1085731382 25 Left 1085731370 11:79001941-79001963 CCTCCACTGTTTTGCTGTCATGC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1085731371_1085731382 22 Left 1085731371 11:79001944-79001966 CCACTGTTTTGCTGTCATGCATT 0: 1
1: 3
2: 1
3: 20
4: 256
Right 1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1085731369_1085731382 26 Left 1085731369 11:79001940-79001962 CCCTCCACTGTTTTGCTGTCATG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1085731372_1085731382 -3 Left 1085731372 11:79001969-79001991 CCCATAGCTCCCCATCTCCCCTG 0: 1
1: 1
2: 0
3: 52
4: 458
Right 1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1085731373_1085731382 -4 Left 1085731373 11:79001970-79001992 CCATAGCTCCCCATCTCCCCTGC 0: 1
1: 1
2: 4
3: 75
4: 661
Right 1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085731382 Original CRISPR CTGCTTTTCTGGTGCATCCA GGG Intronic
900678748 1:3904423-3904445 CTGGTTTTCTGCTCCCTCCAGGG - Intergenic
901439049 1:9266416-9266438 CTGCTTTTCTGAAGCCCCCAAGG + Exonic
902656873 1:17875112-17875134 TTGCTTTTCTGGCCCATCCCTGG - Intergenic
903257798 1:22114424-22114446 CTGCCTTTTTGGGGCAGCCAGGG + Intergenic
903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG + Exonic
903670987 1:25035137-25035159 CAGCCTTTGTGGTGCAGCCAAGG + Intergenic
905217373 1:36418468-36418490 CTGCTATTCTGTAGCAGCCAGGG - Intronic
905847761 1:41246988-41247010 CTTCTTTTCCGATGCATCCTAGG - Intergenic
909937189 1:81565725-81565747 GTGCTTTTCTGGTCCATCAGGGG - Intronic
913518058 1:119622117-119622139 CTGCTATTTTGAGGCATCCAAGG - Exonic
914764148 1:150623074-150623096 CTGCCTTTCTGGGATATCCATGG + Intronic
917702497 1:177595387-177595409 AAGCTTTTCTGGTGCCTTCAGGG - Intergenic
919949365 1:202348560-202348582 CCTTTTTTCTGATGCATCCAGGG + Intergenic
922389273 1:225122320-225122342 CTGCTTGTCAGTTGCAACCACGG - Intronic
1063039536 10:2322676-2322698 CTGCTTTTGTACTGCACCCATGG + Intergenic
1063887364 10:10593318-10593340 CGGCTTTGCTCATGCATCCAAGG + Intergenic
1064237676 10:13591168-13591190 CGTCTTTTCTGTTGTATCCATGG + Intronic
1065776135 10:29121884-29121906 CTGTTTTTCTGGCTCTTCCAGGG - Intergenic
1067300726 10:45006366-45006388 CTGCTTTTTTTGTGCATCTCTGG + Intergenic
1067759416 10:49032357-49032379 CTTATTTACTGCTGCATCCAGGG + Intronic
1071131633 10:82400503-82400525 CAGCTTTTCTGTTTGATCCATGG - Intronic
1073439283 10:103543197-103543219 ATGCTCTTCTGCTGCCTCCAGGG + Intronic
1074258732 10:111830509-111830531 CAGCTGAGCTGGTGCATCCAAGG + Intergenic
1076133087 10:128027336-128027358 CTGCTTTTGTGGGGCCTGCATGG + Intronic
1076246325 10:128950208-128950230 CTGCCCTCCTGGTGCCTCCAGGG - Intergenic
1077116603 11:887972-887994 CTGCATTTCTGGTGGACGCATGG - Intronic
1077485054 11:2834798-2834820 CTGCATTCCTGGGGCAGCCAAGG - Intronic
1078516647 11:12028306-12028328 CTTTTTTTCTGGTGCCTCCCTGG + Intergenic
1080231136 11:30018054-30018076 GAGTTTTTCTGGTGCATGCATGG + Intergenic
1080600492 11:33817471-33817493 CTGCTGGCCTGGTGCATCCCAGG + Intergenic
1083104231 11:60342654-60342676 CTGCTTTTTTGCTGCACACATGG + Intronic
1084748099 11:71186030-71186052 CTGCCTTTCTGAGTCATCCATGG + Intronic
1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG + Intronic
1087728312 11:101749613-101749635 CTGCTCTTCTGCTCCACCCACGG + Intronic
1089069806 11:115690508-115690530 ATGGCTTTCTGGTGCATTCATGG - Intergenic
1096095317 12:48931433-48931455 CTCCTTCTCTGGTCCCTCCAGGG - Intronic
1097328007 12:58301306-58301328 CTGCATTTCTGTTACATTCATGG - Intergenic
1098503104 12:71217214-71217236 CTGCTTATCTTGTTCTTCCATGG + Intronic
1100062637 12:90600147-90600169 CTGGTTTTCTGGTTCATAGATGG - Intergenic
1100929143 12:99585813-99585835 CTGCATTTCTGCTCCAGCCATGG - Intronic
1102217115 12:111169446-111169468 CTGCTTTTCTGGGGCATGGTGGG - Intronic
1102725702 12:115062735-115062757 CTCTTTTTCAGGTGCAACCATGG + Intergenic
1103836217 12:123823273-123823295 CCCATTTCCTGGTGCATCCATGG - Intronic
1104428672 12:128698682-128698704 CTGCTCTGATGGAGCATCCAAGG - Intronic
1105625187 13:22105993-22106015 CTGCTTCTCTGATGCACCCTTGG - Intergenic
1106258152 13:28040340-28040362 CTTTTTTTCTGGTGCCTCTAGGG - Intronic
1107292892 13:38877185-38877207 CTGGTTGTCTGATGGATCCATGG + Exonic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108017167 13:46087409-46087431 CTGTCTTTCTGGTGCATCCTTGG + Intronic
1108146212 13:47479886-47479908 CTGTTTTTCTCTTTCATCCATGG - Intergenic
1112225284 13:97533558-97533580 ATGCTTTTCTGCTGCACCCCGGG + Intergenic
1114303668 14:21401240-21401262 CTACTTTTCTGGGGCCTCCTAGG + Intronic
1114629791 14:24151648-24151670 CTGCTTGTCTGGCCCATCCCAGG - Exonic
1118934623 14:70275597-70275619 CTGCTTATTTGCTGCATACATGG - Intergenic
1119787681 14:77325311-77325333 CTGCTTTTCTGAAGCCTCCGAGG - Intronic
1120782588 14:88499082-88499104 CTGCTCTTCAGGTGAAGCCACGG + Intronic
1121440214 14:93944164-93944186 CAGGGTTTCTGGTGCAGCCAAGG + Intronic
1121787454 14:96673197-96673219 CTGCCTCTCTGCTGCAGCCAGGG + Intergenic
1128022825 15:64407750-64407772 CTGTTTTGCTGGTGTATTCATGG + Intronic
1128948423 15:71848766-71848788 GTGCTTTTGTGGTGTATACAAGG - Intronic
1129025132 15:72564771-72564793 CTGCTTTTCTGGTTCATAGATGG + Intronic
1129773399 15:78217153-78217175 CTGGTTTTCTTTTGCATCCTTGG - Intronic
1132688352 16:1171561-1171583 CTGGTTTTCTGCGGCAGCCAAGG - Intronic
1134183201 16:12063854-12063876 CTGCATTTCTAGACCATCCATGG + Intronic
1136668043 16:31831534-31831556 ATGTTTATTTGGTGCATCCACGG - Intergenic
1140876124 16:79153972-79153994 ATGCTTCTGGGGTGCATCCATGG - Intronic
1141312625 16:82929692-82929714 CTTCTTTTCAGGTTCATCAACGG - Intronic
1141602597 16:85135504-85135526 CTGACTTTCTGGCCCATCCAGGG - Intergenic
1143010786 17:3865232-3865254 CTGCTTTTCTGGACCCTCCTAGG + Exonic
1144415180 17:15039608-15039630 CTGCTATTCTGGTGGATTCATGG - Intergenic
1145757550 17:27403709-27403731 CTTCCTTACTGGTGCCTCCAAGG + Intergenic
1146140714 17:30365607-30365629 CTGCTTTGCTAGTGCCTTCAGGG - Intergenic
1146885004 17:36464686-36464708 CTGCTTTTCTGGGGAAGCCGTGG - Intergenic
1147114679 17:38290080-38290102 CTTCTTTTCTGGCTCAGCCAAGG + Intergenic
1148414934 17:47499125-47499147 CTTCTTTTCTGGCTCAGCCAAGG - Intergenic
1149298559 17:55283704-55283726 GTGCTTTACTGGAGTATCCATGG - Intronic
1151223271 17:72629732-72629754 GTGCTTTTCTGGAGGCTCCAGGG + Intergenic
1151741191 17:75983387-75983409 CTGTTTTTCTGGTGGATCTGGGG - Intronic
1152000737 17:77643919-77643941 CTCCTTTCCTTGTACATCCAAGG - Intergenic
1152848554 17:82617622-82617644 CTGCATTTGTGGGGCACCCAAGG - Intronic
1157795437 18:50570207-50570229 CTGCTTTCCAGCTGCAACCAGGG - Intronic
1159555710 18:69942646-69942668 CCCCTTTGCTGGTGCATGCAGGG + Intronic
1160595454 18:79970587-79970609 CTCCTTCTCTGGTGCAGGCACGG - Exonic
1163429427 19:17258226-17258248 CTGCTGTGCTCCTGCATCCATGG + Exonic
1164947103 19:32305105-32305127 CTGCATTTCTGATGCATCCCAGG - Intergenic
1166617507 19:44263838-44263860 CTGCTTTTCTGCAGCTTGCAGGG + Intronic
1166751969 19:45168522-45168544 CTCCTTTCCTTGTGCATCCTTGG - Intronic
1168440037 19:56356846-56356868 CTGCTTCTCAGGTTCATCCCTGG + Intronic
927278942 2:21286875-21286897 CTGCCTGTCTGGTCCATCCAGGG + Intergenic
929420072 2:41781358-41781380 CTGTTTTTCTGCTGCAGGCAAGG - Intergenic
929995193 2:46821620-46821642 CCACTTTTCTGGGGCCTCCAAGG + Intronic
930621319 2:53646826-53646848 CTACTTTTCTGCTGCACACAGGG - Intronic
930860947 2:56071902-56071924 ATGTTTATTTGGTGCATCCATGG + Intergenic
933967239 2:87440071-87440093 CTGGTTTTCTGGTTTATCCCTGG + Intergenic
934091575 2:88555145-88555167 CAGCTGTTCTGGTGCATGCCTGG - Intergenic
934784634 2:96996115-96996137 CTCCTTTTCTGTTCCTTCCAGGG - Intronic
939417296 2:141916273-141916295 ATGGCCTTCTGGTGCATCCATGG - Intronic
941917471 2:170822112-170822134 CCAGTTTTCTGGTGCATCCATGG - Exonic
942549372 2:177098797-177098819 CTCCTTCTCTGGTGCATCTCAGG + Intergenic
944015299 2:195028445-195028467 GTGCTCTTGTGGTGCAGCCAGGG - Intergenic
947828776 2:233124597-233124619 CAGCTGTTCAGGTGCAGCCAGGG - Intronic
1169376550 20:5071112-5071134 CATCATTTCTGGTGCATCTAAGG - Intronic
1171252145 20:23656494-23656516 CTGCATTTCTGATGCTCCCAGGG + Intergenic
1172242012 20:33419349-33419371 CTTCTTATCTGGTTCTTCCAGGG - Intronic
1173097949 20:40055119-40055141 CCACATTTCTGATGCATCCATGG - Intergenic
1173293476 20:41734702-41734724 CTTTTTCTCTGGAGCATCCATGG - Intergenic
1177095574 21:16827659-16827681 GTGATTTTCTGTTGCTTCCAGGG - Intergenic
1177306025 21:19317152-19317174 CTGCTTTTCTGGGGTATGAAGGG + Intergenic
1181787971 22:25241340-25241362 TTGCTTTTTTGGTGCACCCTGGG + Intergenic
1181819713 22:25466359-25466381 TTGCTTTTTTGGTGCACCCTGGG + Intergenic
1182566377 22:31203096-31203118 CTGCTTAGCTGGGGAATCCAAGG - Intronic
1184875688 22:47274027-47274049 TTGCTTTTCTGGAGCCTCCAGGG + Intergenic
1185003352 22:48260170-48260192 CTGCTGTTCAGGGGCAGCCATGG + Intergenic
949924617 3:9031398-9031420 CTTCCTTCCTGATGCATCCATGG + Intronic
950466871 3:13161008-13161030 CTGCCTTTCTGGAGCTTTCAGGG - Intergenic
950816619 3:15710445-15710467 CTGGTTTTCTTGTTCTTCCAAGG - Intronic
951832831 3:26949636-26949658 CTGCCTTTCTGGTGATTCTAGGG - Intergenic
954996453 3:54886123-54886145 CTGCTTTTGAGGGACATCCAGGG - Intronic
956619845 3:71210916-71210938 CTAATATTCTGGTTCATCCAGGG - Intronic
961793817 3:129395199-129395221 CTGCTGTTCTTGTGCAGGCATGG + Intergenic
961990183 3:131181359-131181381 CTTCCTTTCTGGGGGATCCAAGG - Intronic
963275341 3:143324369-143324391 CTGGTTTTCAGTTGCAGCCAGGG + Intronic
964512438 3:157467589-157467611 CTGCATTTCTGGGACCTCCAGGG + Intronic
964758003 3:160106090-160106112 CTGCTTTTCTGGTGGATTTGGGG + Intergenic
968794074 4:2690307-2690329 CTGCTGTTCTGGCACATGCAGGG - Intronic
970485477 4:16520749-16520771 CTGCTTTTCTGACCCACCCAGGG + Intronic
973005690 4:45003330-45003352 CTTCTTTGGTGGTGGATCCATGG + Intergenic
973140472 4:46761326-46761348 CTGCTTTTTTCATGCAGCCAAGG + Intronic
973944405 4:55942613-55942635 CTTCTTTTCTGCTACATGCAAGG + Intergenic
975958797 4:79875542-79875564 TTGTTTTTCTGGTGCAGCCTGGG - Intergenic
976337790 4:83910894-83910916 CAGCTGTTCTTGTGCATACAGGG + Intergenic
978921404 4:114187335-114187357 ATGCTTTTCTGGTGAAAGCAAGG - Intergenic
979276617 4:118821985-118822007 CTGCTTTTGTGGTGATTCCTAGG - Intronic
980173021 4:129312248-129312270 CTGCCTCTCTGCTGCATCCCAGG + Intergenic
981475322 4:145180959-145180981 CTGCTCTCCTGGTGTTTCCATGG + Intergenic
983118756 4:163852997-163853019 CTGCTTTTCTGATTCATAGATGG - Intronic
985952943 5:3237256-3237278 CTGCCTATCTGCTGCAACCATGG + Intergenic
986520033 5:8605440-8605462 CTACTTTTCTGGGGCAACCCCGG + Intergenic
988705537 5:33722958-33722980 CTGCTTTTCTTGGGCTTCCAGGG - Intronic
994147396 5:96410464-96410486 CTGCTTGTCTGATGCCTCCCTGG - Intronic
995897733 5:117034269-117034291 CTCCTTCTCTGGGGCAGCCATGG - Intergenic
996971217 5:129370594-129370616 CAGTGTTTCTGGTGTATCCAAGG + Intergenic
997471918 5:134122078-134122100 CCTCTTTTCTGCTGCTTCCAAGG + Intronic
999079557 5:148829971-148829993 CTTCCTTTCTGTTGCAGCCAAGG + Intergenic
1004148585 6:13092747-13092769 CTGCTTTTTTACTCCATCCAGGG - Intronic
1004183784 6:13404490-13404512 CTGCTTTTTTGCTACAGCCAAGG + Intronic
1004446841 6:15708111-15708133 CAGCTTCTTTGATGCATCCAAGG - Intergenic
1006695725 6:35929045-35929067 CCTCTTTTCTTGTGCTTCCAGGG - Intergenic
1007228480 6:40331257-40331279 CTGCTTTTGTGGTGATGCCAAGG + Intergenic
1008510204 6:52268889-52268911 CTGATTCTCTGGTGCAGTCAGGG + Intronic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1010249711 6:73695229-73695251 CTGCTTTTATGGTGTAGTCATGG + Intergenic
1012868426 6:104645141-104645163 ATGATTTTATTGTGCATCCAAGG - Intergenic
1015196477 6:130529457-130529479 CAGCTTTCCTGGTACATTCATGG - Intergenic
1016978785 6:149834723-149834745 CTGCTTTTTTGGTCCATTCCTGG - Intronic
1017899365 6:158705920-158705942 CTGTTTTTCTCTTGCTTCCATGG + Intronic
1018437846 6:163778921-163778943 CATCTTTTCTGTTGCATGCATGG + Intergenic
1018567713 6:165173176-165173198 CTGCTTTTATGTTTAATCCAAGG - Intergenic
1021973694 7:25990238-25990260 CTGCGTTTCTGGTGCCCTCAGGG + Intergenic
1022089536 7:27098377-27098399 CCTCTTTTCTGGGGCATCCTGGG + Intergenic
1023939183 7:44759270-44759292 CTCTTTTTCAGGTGTATCCAGGG + Exonic
1024540923 7:50474455-50474477 CTGTTCTTCTGCTCCATCCAGGG - Intronic
1028086069 7:86639397-86639419 CTGATTTTCAGTTACATCCAAGG - Intergenic
1029213883 7:98931178-98931200 CAGCTTATCTGGTGAATGCAGGG + Intronic
1032370351 7:131343764-131343786 CTGCTTTTCCGGGGCATACAGGG + Intronic
1036630808 8:10513476-10513498 CTATTTTCCTGGTTCATCCATGG - Intergenic
1036684422 8:10899725-10899747 CTGGTTTTCTGAGGCTTCCAAGG + Intronic
1038104222 8:24415054-24415076 CTGCATTTCTCGTGCATCAGAGG + Intergenic
1038485337 8:27931188-27931210 CTGGTTTTCTCCTGCATCCCAGG - Intronic
1038962104 8:32532094-32532116 CTGCTTGTCTGGTGCATGTGTGG - Intronic
1039997909 8:42550445-42550467 CTGTTTTTCTAGAGCCTCCAAGG + Intronic
1040639707 8:49319199-49319221 ATGCATTTCTGCTGTATCCAAGG + Intergenic
1040934614 8:52769399-52769421 CTGCTTTTGTGGTGGAGCCTTGG + Intergenic
1041387354 8:57318692-57318714 CTACTTTTCTGCTGCACACAGGG - Intergenic
1042097641 8:65234971-65234993 CTGCTTTCCATGAGCATCCAGGG - Intergenic
1042492514 8:69416244-69416266 CTGCTTCCCTGGTTCTTCCAGGG - Intergenic
1042659601 8:71140143-71140165 CTGCTTTACTTCTTCATCCAGGG + Intergenic
1042830921 8:73027662-73027684 CTTCTTTTCTGTTGAACCCATGG + Intronic
1044214522 8:89593238-89593260 CTCCTGTTCTAGTGCATGCAAGG - Intergenic
1046249519 8:111611841-111611863 CTGCTTTGCTGCAGCAGCCAGGG - Intergenic
1048444742 8:134484937-134484959 CTGCTTTCTTTGTTCATCCAAGG - Intronic
1050119644 9:2295351-2295373 CTGCCTTTCCGGTGTAGCCAAGG - Intergenic
1050686913 9:8181741-8181763 CTGCTGTCATGGTGCATCAATGG + Intergenic
1051115445 9:13688668-13688690 CTGCTTCTCTGGCGTCTCCAGGG + Intergenic
1052459490 9:28744362-28744384 CTGCTTTTCTTTTGCCTGCATGG + Intergenic
1056499766 9:87197374-87197396 CTTCTTTTCTGGTCCTTCCTGGG - Intergenic
1186731497 X:12415288-12415310 CTGCTTTTCTGATGCAACTTTGG - Intronic
1187265543 X:17729204-17729226 CTGAGATTTTGGTGCATCCATGG - Intronic
1188014874 X:25097323-25097345 ATGTTTATTTGGTGCATCCACGG + Intergenic
1188673464 X:32909658-32909680 CTGCTTTTTTGTTGCATTCATGG - Intronic
1192797228 X:74434125-74434147 TTCCTTCTCTGGTGCATCCAAGG - Intronic
1193198147 X:78657899-78657921 CTGGTATTCTGGTGCCTCCTGGG + Exonic
1193479497 X:82010252-82010274 CTGCTATTCAGGTGTTTCCAGGG + Intergenic
1193499677 X:82260273-82260295 ATGTTTATTTGGTGCATCCATGG - Intergenic
1195355613 X:104037069-104037091 CTGATTTTCTCGTGCAGCCACGG - Intergenic
1196881695 X:120204709-120204731 CTGCTTTTCTGTTTTATCCATGG + Intergenic
1198924116 X:141768674-141768696 CTGCTTTTGCGTTGCATCAATGG - Intergenic
1200523959 Y:4248007-4248029 TTGCTGTTCTGTTGCCTCCATGG + Intergenic