ID: 1085732940

View in Genome Browser
Species Human (GRCh38)
Location 11:79014599-79014621
Sequence CTTCATGCACAGAGGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085732931_1085732940 28 Left 1085732931 11:79014548-79014570 CCTGGGTCCAGAGCACAAAATAC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG 0: 1
1: 0
2: 0
3: 19
4: 203
1085732934_1085732940 6 Left 1085732934 11:79014570-79014592 CCTTTGCACTTCATTAGGCCCCA 0: 1
1: 0
2: 1
3: 9
4: 184
Right 1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG 0: 1
1: 0
2: 0
3: 19
4: 203
1085732932_1085732940 21 Left 1085732932 11:79014555-79014577 CCAGAGCACAAAATACCTTTGCA 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG 0: 1
1: 0
2: 0
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085732940 Original CRISPR CTTCATGCACAGAGGCCACC AGG Intronic
901192324 1:7420036-7420058 TTTCCTGCTCAGAAGCCACCAGG + Intronic
901894042 1:12293578-12293600 CATACTGCACAGAGGCCATCCGG - Exonic
901973604 1:12927377-12927399 CTTCATGCACATCTCCCACCGGG + Intronic
902011574 1:13274390-13274412 CTTCATGCACATCTCCCACCGGG - Intergenic
902578254 1:17392174-17392196 CCTCATAGACAGATGCCACCTGG - Exonic
902726152 1:18337572-18337594 CTTCACGCACCGTGGCAACCTGG + Intronic
904306338 1:29592637-29592659 CTTGATGCTCAGATGCCAGCAGG - Intergenic
905524626 1:38626867-38626889 TGTCCTGCACATAGGCCACCAGG + Intergenic
905862011 1:41358140-41358162 CTGCATCCCCAGAGCCCACCTGG - Intergenic
910192864 1:84612162-84612184 CTCTATGCACATAGGACACCTGG + Intergenic
912273428 1:108232367-108232389 CTTCATTCACAGAGTCCTCTGGG + Exonic
912294792 1:108461955-108461977 CTTCATTCACAGAGTCCTCTGGG - Exonic
912583230 1:110738370-110738392 CATCCTGCCCAGAGGGCACCTGG + Intergenic
912934135 1:113988044-113988066 CTTTATGCCCTGAGGCCACAGGG + Intergenic
913445687 1:118948311-118948333 CCTCTTACACAGAGGCCACTAGG + Intronic
915553504 1:156648338-156648360 AGTCATGCACAGAGTCCACCTGG - Intronic
918232865 1:182551431-182551453 CGGCATGCACAGAGGCGTCCTGG - Intronic
919789207 1:201279503-201279525 CTTCCTGGACAGCGGCCACGGGG - Intergenic
919989607 1:202700159-202700181 CCTCATCCCCAGAGGCCACCTGG + Intronic
921379610 1:214511014-214511036 CTACAGGCACACATGCCACCAGG + Intronic
921825453 1:219667206-219667228 CTGCATACCCAAAGGCCACCGGG + Intergenic
922004040 1:221510966-221510988 CTACATGCACATAGGGCACCTGG - Intergenic
923316797 1:232788391-232788413 CCTCTGTCACAGAGGCCACCTGG + Intergenic
1067474248 10:46555983-46556005 CCTCCTGCACAAAGCCCACCCGG + Intergenic
1069907762 10:71741879-71741901 CGTCCTCCACAGTGGCCACCAGG - Intronic
1072899420 10:99394099-99394121 CTTCATCACCTGAGGCCACCAGG + Exonic
1073378083 10:103054186-103054208 CTCTATGCACAGATGCCACGGGG - Intronic
1073690933 10:105808702-105808724 CTCCAGGCACAAAGGCTACCTGG + Intergenic
1076539449 10:131204896-131204918 CTTCAAGCAGAAAGGCCACTGGG - Intronic
1076543121 10:131226981-131227003 CTCCCTGCCCAGAGCCCACCTGG - Intronic
1076834669 10:133014989-133015011 CTTCCTGCCCAGAGGCAGCCCGG - Intergenic
1076838565 10:133033390-133033412 CTGCATGCTCTGTGGCCACCAGG + Intergenic
1076873604 10:133205307-133205329 CTTCATGCACAGACAGCAGCTGG - Intronic
1078186128 11:9053394-9053416 CTTCATGCAGAAAAGCAACCAGG + Intronic
1084483800 11:69436679-69436701 GTTCAGGCACAGAGGCCGCATGG + Intergenic
1084727060 11:70948751-70948773 CCACATGCACAGAGGCTGCCTGG + Intronic
1085155231 11:74287173-74287195 AGTCATGCAAAGAGGCCAGCAGG - Intronic
1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG + Intronic
1086592126 11:88527389-88527411 TTTCATAAACAGAGGTCACCTGG - Intronic
1087309757 11:96527871-96527893 CTGCATGCACAGTCGCCAGCAGG + Intergenic
1088817395 11:113431078-113431100 ATGCATGCCCAGGGGCCACCTGG - Intronic
1089770909 11:120802356-120802378 CTCCATGCACACAGGCAAGCAGG - Intronic
1089930608 11:122307147-122307169 CCTCCTGGACAGAGGCCACTAGG + Intergenic
1092196747 12:6554497-6554519 CTTCATCCACAGAATGCACCGGG + Intronic
1092533602 12:9365685-9365707 CTTCATGCACAGAAGTTACAGGG - Intergenic
1094544665 12:31393333-31393355 CTTCAGGCCCAGATGCCACAGGG - Intronic
1095532307 12:43202866-43202888 CTTCATGCCCAAAGTGCACCAGG + Intergenic
1095878080 12:47103920-47103942 CTGGATGCACAGGGGCCATCGGG - Intronic
1097650556 12:62292605-62292627 GCTCAAGCACAGAGGCCACTTGG + Intronic
1100574688 12:95879537-95879559 CTACATTCACAGAGACCACGAGG + Intronic
1103193978 12:119026061-119026083 CTTCAACCACAGAGGGCACCAGG - Intronic
1103505564 12:121440659-121440681 CTTCAGGCACAGAGGGGATCTGG - Intronic
1107112939 13:36717101-36717123 CTTCTTGCCCTGAGGCCACAGGG + Intergenic
1107285032 13:38781168-38781190 CTTCAAGCACACTGGCCTCCTGG + Intronic
1115147160 14:30239112-30239134 CTTCATGCACAGTGGCCTGCTGG - Intergenic
1115645016 14:35363185-35363207 CTTCCTGCACTGAGGGCAACAGG + Intergenic
1117505716 14:56401083-56401105 CTTCCTGCACAGAGACCTCTTGG + Intergenic
1119793550 14:77376404-77376426 CTTCCTGCACATAGGCCCCCTGG - Intronic
1120012579 14:79434420-79434442 CTTCATGAACACCTGCCACCTGG + Intronic
1121508272 14:94492936-94492958 CCTCCTGCACAGAGGCCAGGTGG + Intronic
1122525386 14:102379458-102379480 ATCCATGCACAGAGGCGTCCTGG + Intronic
1122525391 14:102379509-102379531 ATCCATGCACAGAGGCGTCCTGG + Intronic
1122525438 14:102380121-102380143 ATCCATGCACAGAGGCGTCCTGG + Intronic
1122763640 14:104049700-104049722 CTACATGAGCAGAGGCCACGTGG + Intronic
1122969218 14:105145700-105145722 CTGCAAGCTCAGATGCCACCAGG + Intronic
1123138699 14:106054723-106054745 CTCCATGCACAGAAGACAGCAGG + Intergenic
1123139470 14:106061391-106061413 CTCCATGCACAGAAGACAACAGG + Intergenic
1123187787 14:106537039-106537061 CTCCATGCACAGAAGACAGCAGG + Intergenic
1124415159 15:29467619-29467641 TTCAATGCACAGAGACCACCCGG + Intronic
1127429875 15:58894490-58894512 CTTCAAGCACAGAGGTGTCCAGG - Exonic
1131400086 15:92117784-92117806 CTTCATGTACAGAAGCCCCTTGG - Intronic
1131643026 15:94312963-94312985 TTCCATGCACAGTGACCACCTGG - Intronic
1131816688 15:96228580-96228602 CTCCATACACAAAGGGCACCTGG - Intergenic
1131829564 15:96345353-96345375 CTTCCCCCACCGAGGCCACCCGG + Intergenic
1132611568 16:819263-819285 CAACATGCACTGGGGCCACCAGG - Intergenic
1134399622 16:13897492-13897514 CATCATGCACACAGGCCTCAGGG - Intergenic
1136694696 16:32067098-32067120 CTCCATGCACAGAAGACAACAGG - Intergenic
1136795198 16:33010360-33010382 CTCCATGCACAGAAGACAACAGG - Intergenic
1136874718 16:33844022-33844044 CTCCATGCACAGAAGACAACAGG + Intergenic
1139926694 16:70492147-70492169 GTTCCTGGACAGTGGCCACCTGG + Intronic
1142048003 16:87938110-87938132 CTTCATGCCCAGGGTCCACATGG + Intergenic
1203097451 16_KI270728v1_random:1272020-1272042 CTCCATGCACAGAAGACAACAGG - Intergenic
1146978866 17:37140969-37140991 CCCCATGCACAGAGGCTACTGGG - Intronic
1148462695 17:47847442-47847464 CTTCATGCGCAGCGACCACCTGG - Exonic
1149428674 17:56579137-56579159 CTTCAGCCTCAGAGGCTACCAGG + Intergenic
1150531708 17:65990562-65990584 CTGCCTGCAGAGAGGGCACCTGG + Intronic
1151187470 17:72374506-72374528 CTTCATGGAATCAGGCCACCAGG + Intergenic
1152094168 17:78263523-78263545 CCTCAGGCACAGTGGCCATCTGG + Intergenic
1152097070 17:78278534-78278556 CTTCAAGCACAGCTGGCACCTGG - Intergenic
1152198838 17:78933611-78933633 CTTCCTGCAGGGAGGCCGCCCGG + Intergenic
1153589067 18:6654133-6654155 GCTCATGCCCAGAGGTCACCTGG + Intergenic
1153858521 18:9174485-9174507 CCTCATGAACCCAGGCCACCAGG - Intronic
1154075669 18:11198534-11198556 CTTCATTCAGGGAGACCACCAGG + Intergenic
1155887483 18:31225778-31225800 ATTCATGCACACAGGCTCCCAGG + Intergenic
1156504115 18:37578093-37578115 CTGCAAGCACAGTGGCCAACCGG - Intergenic
1156679996 18:39576739-39576761 CGACATGCACAGTGGCCAGCTGG - Intergenic
1158119757 18:54036113-54036135 CATTACACACAGAGGCCACCAGG + Intergenic
1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG + Intronic
1160742016 19:690796-690818 CCCCATGCACAGAGGCTACTGGG + Intronic
1160753395 19:746093-746115 CTGCATCCACAGATGCCAACAGG + Intronic
1161477859 19:4496330-4496352 CCTCAAGCACAGAGCCCGCCAGG + Exonic
1161924368 19:7290042-7290064 ATTCATGCATAGAGACCACAGGG - Intronic
1164282361 19:23780130-23780152 CTTCATACAGAGAGGAGACCTGG - Intronic
1164312959 19:24062125-24062147 CTTCATACAGAGAGACCACCAGG - Intronic
1164402415 19:27911134-27911156 CTGCATGAAAAGGGGCCACCAGG + Intergenic
1165062190 19:33210394-33210416 CTGCATCCACAGTGGGCACCAGG - Intronic
1165136574 19:33673556-33673578 CTCCTTGCACAGTGGCCACCAGG + Intronic
925037179 2:697155-697177 CTGCATGCACAGCGGCGTCCCGG - Intergenic
925333112 2:3074182-3074204 CTTCCTTCAAGGAGGCCACCTGG - Intergenic
926020900 2:9494950-9494972 CTTCAGTGACAGAGGCCACAAGG + Intronic
926411584 2:12608821-12608843 CTTCATCCATGGAGTCCACCCGG - Intergenic
927062358 2:19435766-19435788 GTTCATTCACAAAGGCCAGCAGG + Intergenic
927504138 2:23602365-23602387 GCTCCTGCACAGAGGCCTCCTGG + Intronic
930004192 2:46882888-46882910 CTTCATGTACACAAGCCACATGG - Intergenic
931827540 2:66017276-66017298 CTCCATGGACAGAAGCCACTTGG - Intergenic
934916530 2:98305004-98305026 CTGCTTCCACAGAGGCCACACGG + Intronic
942487306 2:176452980-176453002 GATCATTCACTGAGGCCACCTGG + Intergenic
944501902 2:200370039-200370061 CGTCATGGACTGGGGCCACCTGG + Intronic
944972524 2:205010322-205010344 GTTCATGCACAGAGGCTGCAAGG - Intronic
947668655 2:231923134-231923156 CAGCATGCACAGAGGGGACCTGG + Intronic
948056479 2:235012555-235012577 CTGCAGGCACACAGGTCACCCGG - Intronic
948291040 2:236825020-236825042 CTACATAAACAAAGGCCACCTGG - Intergenic
948388081 2:237593983-237594005 CCTCCTGCACAGAGGTCATCTGG + Intronic
948389406 2:237601270-237601292 CACCCTGCACAGAGGTCACCAGG + Intronic
948930752 2:241130431-241130453 CTTGGTGGACAGAGGCCACGTGG - Intronic
1169899067 20:10534689-10534711 GTGCATGAACAGAGGCCAGCAGG + Intronic
1170838548 20:19905408-19905430 TTTCAAGCACAGATGCCAGCTGG - Intronic
1175061256 20:56245534-56245556 TTTCAGGCAAAGAGACCACCTGG + Intergenic
1175733557 20:61370382-61370404 CTGCATGCCCAGGGACCACCTGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175885815 20:62290092-62290114 CTGCAAGCACAGAGCCCACCGGG - Intronic
1179633945 21:42695580-42695602 CTGCATGCACAGAGCTCAGCCGG - Intronic
1179847493 21:44119542-44119564 CCCCAGGCACAGAGGCCAACGGG - Intronic
1180969388 22:19807219-19807241 CTCGATGCACAGGGGACACCGGG - Intronic
1181433930 22:22899502-22899524 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181434868 22:22904871-22904893 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181436481 22:22914156-22914178 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181459288 22:23076795-23076817 CTTGGGGCACAGGGGCCACCTGG - Intronic
1182547390 22:31084146-31084168 CTCCATGCACAGAGGCCGTAGGG + Intronic
1182944227 22:34306768-34306790 CTTCAACTACAGAAGCCACCTGG - Intergenic
1184020082 22:41814888-41814910 CTGCATGCACAGCGCCCACCTGG - Intronic
1184311035 22:43643000-43643022 TCTCAAGCACAGAGCCCACCAGG + Intronic
1185127605 22:49020163-49020185 CTCCCTTCACAGAGGACACCAGG + Intergenic
950582380 3:13871032-13871054 CTTCAGTCACAGAGTCCAGCTGG + Intronic
950863357 3:16169848-16169870 CTTCAGGCACTGCGGACACCAGG + Intergenic
954216685 3:49128699-49128721 CCTTCGGCACAGAGGCCACCAGG + Exonic
954218050 3:49135310-49135332 CATCCTGCACAGTGGCTACCAGG + Intergenic
955410811 3:58654265-58654287 CTTCAGGCACAGAGCAGACCTGG + Intronic
958673327 3:97232844-97232866 CTTCATGCACAGTGGCCTGCTGG + Intronic
960219388 3:115087048-115087070 GTTCAAGCACAGAGGCTAACTGG + Intronic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
967266989 3:187699803-187699825 TTACATGCACAGAGGCCACTTGG + Intronic
967829542 3:193907125-193907147 CCTGAAGCACAGAGACCACCTGG - Intergenic
968936076 4:3611288-3611310 GTTCATGGGCAGAGGCCTCCAGG + Intergenic
970863592 4:20733809-20733831 TTTCTTGCACAGAGGACACCTGG - Intronic
971381157 4:26099194-26099216 TTTCCTGTACAGAGGGCACCAGG - Intergenic
971444668 4:26730732-26730754 CTTCATGGACAGAAGCCTGCAGG + Intronic
972397227 4:38667791-38667813 CTCCATCCACGGAAGCCACCTGG - Intronic
978490374 4:109305280-109305302 CTTGATGCAGAGAGTCTACCAGG - Intergenic
985164024 4:187073962-187073984 CAGCCTGCACAGAGGCCATCTGG - Intergenic
988290347 5:29276259-29276281 CATCATACACTGAGGCCAGCTGG + Intergenic
990516200 5:56533123-56533145 CTCCATGGAAAGAGCCCACCTGG + Exonic
991511441 5:67381244-67381266 CTTCATCTAAAGAGGCAACCTGG - Intergenic
992208689 5:74456060-74456082 CTCCATGCTCAGATGCCACAAGG + Intergenic
993631444 5:90290911-90290933 TTTCATCCTCAGTGGCCACCTGG - Intergenic
995651630 5:114376304-114376326 CTTCCTGCACAGAGACCACACGG + Intronic
996994477 5:129678217-129678239 CTTCATGCACATGGGTCTCCTGG + Intronic
1002074314 5:176699073-176699095 CCAGATGCACAGAGGCCACAAGG - Intergenic
1002586293 5:180250850-180250872 CTTCATGCAGGGAGGCAGCCCGG - Intronic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1007088230 6:39165850-39165872 ATTGATGCACAGAGACCACCAGG - Intergenic
1009517725 6:64641215-64641237 CTTCTTGCACAGATGGCAGCAGG + Intronic
1013463736 6:110399696-110399718 CTGCATGGCCAGGGGCCACCGGG + Intronic
1014219611 6:118786878-118786900 CTGCGTGCACAGCAGCCACCTGG + Intergenic
1015182131 6:130371612-130371634 ATTCATGCTCAGAGCCAACCTGG + Intronic
1017808065 6:157963486-157963508 CTTCCTGCTCACATGCCACCAGG + Intergenic
1018164800 6:161083106-161083128 CTCCATGCAGAGGGGCCAGCTGG - Intronic
1022477618 7:30722096-30722118 CTCCAGGGTCAGAGGCCACCAGG + Intronic
1022478903 7:30730162-30730184 CCTGGTGCACAGAGCCCACCTGG + Intronic
1022623009 7:32004402-32004424 CTTACTGCATACAGGCCACCTGG + Intronic
1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG + Intronic
1023851010 7:44150384-44150406 CTGCATGCACAGGTGCCACCTGG + Intronic
1024053683 7:45646126-45646148 CTGAATGCACAGAGCACACCAGG + Intronic
1024295218 7:47836323-47836345 ATTCATGCACCCAGCCCACCGGG - Intronic
1024474737 7:49798521-49798543 CTTCCTGCTCAGAGTCCTCCAGG - Intronic
1024540061 7:50468780-50468802 CTTGATGGACAGAGGTCCCCAGG - Intronic
1031993584 7:128213423-128213445 CTCCAGGCAAAGAGGCAACCAGG + Intergenic
1032348162 7:131136071-131136093 CTTCATGAACTGAGGCCAGGAGG - Intronic
1032487273 7:132297264-132297286 CATCCTCCACAGAGGCCACAGGG + Intronic
1034316174 7:150135400-150135422 CTTCATGCTCAGTGGCCATGAGG + Intergenic
1034538204 7:151739027-151739049 CTCCATCCACAGAAGCCAACCGG + Intronic
1034790713 7:153965387-153965409 CTTCATGCTCAGTGGCCATGAGG - Intronic
1035287904 7:157817723-157817745 GTGCATGCACACAGGCCACACGG - Intronic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1035775187 8:2182377-2182399 CCAAATGCTCAGAGGCCACCTGG - Intergenic
1036208556 8:6823641-6823663 CTTCATGAAGCCAGGCCACCTGG - Exonic
1038472731 8:27838858-27838880 GTACAGCCACAGAGGCCACCTGG + Intergenic
1040018407 8:42719130-42719152 CTTAATCCCCAGATGCCACCAGG + Intronic
1045252139 8:100491180-100491202 CTTCATGAATAGAGTCCAGCAGG - Intergenic
1047553600 8:125904081-125904103 CCCAATGCACAGAGACCACCAGG - Intergenic
1047625042 8:126647726-126647748 CTTCATGCCCAGAGGATACATGG - Intergenic
1054454211 9:65421154-65421176 GTTCATGGGCAGAGGCCTCCAGG - Intergenic
1054734876 9:68740883-68740905 CTTCAGGCTCAGAAGCCACTTGG + Intronic
1057825219 9:98368017-98368039 CTTCATGCACAGAGGGGATCAGG - Intronic
1059523373 9:114965076-114965098 CTTCATCCAGTGAGGCCAACGGG - Intergenic
1060458177 9:123820413-123820435 CTGAATGCAGAGAGGCCACATGG + Intronic
1060836463 9:126758701-126758723 CTTCTTACCCAGAAGCCACCTGG - Intergenic
1060957372 9:127652227-127652249 CTTCATGCATAGGGGGCAGCAGG - Intronic
1061508889 9:131048644-131048666 CCTCAGGCAAGGAGGCCACCTGG - Intronic
1062402334 9:136378113-136378135 CTCCAGGCCCAGAGGCCCCCTGG + Exonic
1062623947 9:137434655-137434677 CTTTCTGCACACAGGCCGCCAGG - Exonic
1187269702 X:17768672-17768694 CTTCCTCCACAGGGCCCACCAGG - Intergenic
1187857676 X:23652724-23652746 TTTCATGCACAGAAGCAAGCAGG + Intergenic
1189499026 X:41537458-41537480 TTACATGCACAGAGGCCATTGGG + Intronic
1189634052 X:42986103-42986125 CTTCATGGAAAGAGCCCTCCAGG + Intergenic
1190390018 X:49922654-49922676 CTTCATTCACACAGCCCAGCCGG - Exonic
1190778012 X:53569674-53569696 CTTCATTCACTAGGGCCACCTGG + Exonic
1191882899 X:65860186-65860208 CCTCATGTACAGAGGCCAATGGG + Intergenic
1195465741 X:105176790-105176812 ATTCATTCACATAGTCCACCTGG - Intronic
1196167901 X:112555499-112555521 CTTCATGAGCACACGCCACCAGG + Intergenic
1197675012 X:129320000-129320022 CTTCATGCACAGATGACATTTGG - Intergenic
1197808087 X:130416377-130416399 CCTCATGCACTGAGGTCAGCAGG - Intergenic
1199354768 X:146849325-146849347 CTTCATGCATAGTGCCCACTTGG - Intergenic