ID: 1085735568

View in Genome Browser
Species Human (GRCh38)
Location 11:79036139-79036161
Sequence GAGTCAGTGGGGTCTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085735568 Original CRISPR GAGTCAGTGGGGTCTGGAGT GGG Intronic
900188839 1:1344933-1344955 GAGTCAGAGGGTGCTGGGGTTGG - Intronic
900564363 1:3325079-3325101 GAGGCAGTGGGGCCTGGAAGAGG - Intronic
900877839 1:5358414-5358436 AACTCAGTCTGGTCTGGAGTGGG + Intergenic
902207072 1:14876542-14876564 GAGGGAGTGGGGTCTGGAGCTGG + Intronic
903265637 1:22156432-22156454 CAGTCAGTGGGGTGGGGACTGGG - Intergenic
903545200 1:24119620-24119642 AAGCCAGAGGGGTCTGGGGTGGG - Intergenic
903981861 1:27194602-27194624 GAGGCAGAGTGGACTGGAGTTGG - Intergenic
904419937 1:30385007-30385029 CAGTCAGTGGAGGCTGGAATTGG - Intergenic
904479718 1:30786324-30786346 AAGAGAGTGGGCTCTGGAGTGGG + Intergenic
904856089 1:33499216-33499238 AAGGCAGTGATGTCTGGAGTGGG + Intergenic
904892482 1:33789587-33789609 GAGGCAGGGGGTTGTGGAGTGGG + Intronic
905134470 1:35787848-35787870 GAGACTGTGGGGGCTGGGGTAGG - Intergenic
906343293 1:44999408-44999430 GAGTCAGTTGGCTTTGGAGCTGG + Intergenic
907496931 1:54851521-54851543 GACTCAGTGGTGGCTGGGGTGGG + Exonic
907667244 1:56444120-56444142 GAGTCAGAGGGTTCTGGACTAGG + Intergenic
907747245 1:57225269-57225291 TTGTCACTGGGGTCTGGAGTGGG + Intronic
907909373 1:58813710-58813732 GAGTTGGTGGGGTGAGGAGTAGG - Intergenic
908589693 1:65617102-65617124 GCGTCAGTGGGGTAGGTAGTGGG + Intronic
908642728 1:66243241-66243263 AAGGCAGTGGGGTCTGAGGTGGG + Intronic
911564875 1:99452108-99452130 AAGTCTGTGGTGACTGGAGTGGG - Intergenic
911755450 1:101548856-101548878 GAGTCAGTTGGCCCTGGACTTGG + Intergenic
912496944 1:110097968-110097990 GAGGCTGTGGGGTGTGGAGGAGG - Intergenic
912860101 1:113206649-113206671 GAGTCCGTGGGTTCAGGAGCTGG + Intergenic
914392797 1:147237107-147237129 GTGTCAGTGCTGCCTGGAGTGGG + Intronic
915419030 1:155765133-155765155 CAGTCAGTGGGGACTCCAGTTGG - Exonic
915621808 1:157090818-157090840 GAGGCAGTGGGGTCTGGCAGAGG + Intergenic
916769625 1:167895385-167895407 TAGGCAGTGGGGTGGGGAGTGGG - Intronic
918046956 1:180947422-180947444 GAGACAGTGGTGCCTGGACTGGG + Exonic
920794308 1:209123946-209123968 AAGTCAATGGGGTATGGAGTGGG - Intergenic
922233107 1:223703159-223703181 CAGTCAGTGGGTAGTGGAGTTGG - Intronic
922914023 1:229240927-229240949 GAGTGACTGGGGGCTGGAGGGGG - Intergenic
922987209 1:229874991-229875013 GAGGAAGTGGGGTCAGGAATAGG + Intergenic
924473450 1:244363670-244363692 GAGACAGTGGCGTTGGGAGTAGG - Intronic
924870610 1:248039990-248040012 GACTTAGTGGAGTGTGGAGTAGG + Intronic
924954791 1:248915915-248915937 GAGTCTGAGGGGACAGGAGTGGG + Intronic
1065797223 10:29318813-29318835 GAGAGAGTGGGTTCTGGAGCGGG - Intergenic
1065945932 10:30605520-30605542 GAGAGAGTGGGTTCTGGAGCGGG + Intergenic
1066986732 10:42475209-42475231 GAGTCTGGGGAGGCTGGAGTGGG - Intergenic
1068731729 10:60365835-60365857 GAGTCAGTCAGCTCTGGAGTAGG - Intronic
1070696089 10:78564213-78564235 GAGTCAGTGAAGTCTGCAGAGGG - Intergenic
1071563807 10:86661523-86661545 CACTGAGTGGGGTCTGGAGTTGG + Intronic
1071937247 10:90545723-90545745 GAGTCAGTGGGCTGGGGAGAGGG + Intergenic
1072290424 10:93959955-93959977 GAGAAACTGGGGTCAGGAGTAGG + Intergenic
1073132940 10:101202070-101202092 AAGTCAGTGGGGGACGGAGTGGG - Intergenic
1073485861 10:103818812-103818834 GACCCAGTGAGGTCTGGAGAAGG - Intronic
1073788835 10:106919323-106919345 GAGTCACTGGGATCTGAAGGGGG - Intronic
1075007330 10:118840334-118840356 GAGTCATTTGGGTGTGGAGCTGG + Intergenic
1075059691 10:119247129-119247151 GGGTAAGAGAGGTCTGGAGTTGG - Intronic
1075586169 10:123659656-123659678 GGGTGAGTGGGGGCTGGAGTGGG + Intergenic
1075793577 10:125103240-125103262 GGGCCAGGGGGGTGTGGAGTGGG - Intronic
1076240333 10:128900361-128900383 GAATAACTGGGGTCTGGAGAGGG - Intergenic
1076275950 10:129198776-129198798 GAATTAGTGGTGTTTGGAGTAGG + Intergenic
1076825825 10:132967498-132967520 AAGTCAGAGGGGGATGGAGTGGG + Intergenic
1077610338 11:3639973-3639995 GAGGCAGTGGGGGCTGCAGCAGG - Exonic
1077614001 11:3662072-3662094 GAGACAGTGGGTTCTGCACTGGG - Intronic
1078791477 11:14546831-14546853 GAGTCAGTTGGATATAGAGTGGG + Intronic
1079130554 11:17744649-17744671 CAGGCTGTGGGGTCTGGAGCAGG + Intronic
1079167187 11:18055624-18055646 GAGTCTTTGAGGTCAGGAGTTGG + Intergenic
1079414562 11:20221574-20221596 CAGTTGGTGGGGTGTGGAGTGGG + Intergenic
1080217937 11:29867046-29867068 CAGTCAGTGGGCTCTGGGATGGG - Intergenic
1080476346 11:32595445-32595467 GGGTCAGGGGGGTCAGGAGTCGG - Intronic
1080729000 11:34929049-34929071 GAGTCATGGTGGACTGGAGTTGG + Intronic
1080732029 11:34966695-34966717 GTGGCTGTGGGGGCTGGAGTTGG - Exonic
1081611041 11:44563630-44563652 GAGGGAGCGGGGTGTGGAGTAGG + Intergenic
1081755644 11:45542404-45542426 GAGAAATTGGGGTCTGGAGAGGG - Intergenic
1081958137 11:47111554-47111576 GAAGGAGTGGGGTGTGGAGTGGG - Intronic
1081987477 11:47316609-47316631 GGATCAGTGAGGTCAGGAGTTGG - Intronic
1083332673 11:61906220-61906242 GAGTCAGTGGGGCAGGGAGGGGG + Intronic
1083575070 11:63784430-63784452 AGGTTAGAGGGGTCTGGAGTTGG - Intergenic
1084737348 11:71114072-71114094 GAGTCACTGGAGTTTGGAGCTGG + Intronic
1085339806 11:75723811-75723833 TAGGCAGTGGGGCCTGGAGAAGG - Intronic
1085735568 11:79036139-79036161 GAGTCAGTGGGGTCTGGAGTGGG + Intronic
1086434320 11:86766223-86766245 CACTCAGTGGGTTCTGGGGTTGG - Intergenic
1087822809 11:102730917-102730939 GAGTGAGTGGTGTGAGGAGTGGG - Intergenic
1087903767 11:103671977-103671999 GAGTCAGTGGGGACCGGGCTTGG + Intergenic
1089151339 11:116366733-116366755 AAGTCAGGAGGGTCTTGAGTTGG - Intergenic
1089336043 11:117724780-117724802 GTGTCAGGGGGGTGTGGAGAAGG - Intronic
1090405053 11:126471475-126471497 GGGTCAGTTGGGGCTGGGGTGGG + Intronic
1092181705 12:6451048-6451070 GAGCCAGTGGGGTGTGGTGCAGG - Intronic
1094020140 12:25905091-25905113 AAGTCACTGGGCTCTGGAGCTGG + Intergenic
1094426616 12:30322882-30322904 AAGTCAGTGGAGTTGGGAGTAGG - Intergenic
1095980510 12:47971260-47971282 GAGTAAGTAGGCTCTGGAGTTGG + Intergenic
1096144094 12:49265625-49265647 GAGTCACTGGGCGCTGGAGAGGG - Intronic
1096216152 12:49798451-49798473 GAGTGAGTGGGATCTGCAGAGGG + Exonic
1096469594 12:51867994-51868016 GAGTCAGTGGCTTCTGGGCTGGG - Intergenic
1099246173 12:80196090-80196112 AAGTGAGTGGGGTCTGGAGGTGG + Intergenic
1101794148 12:107957332-107957354 GAGGCAGTGGTGTCAGGAGGTGG + Intergenic
1102569463 12:113818783-113818805 GAGACAGTGGGGACGGGAGGAGG - Intronic
1102569473 12:113818817-113818839 GGGACAGTGGGGCCTGGAGGAGG - Intronic
1104387317 12:128362258-128362280 GAGTCAGTATGATCTGGAGATGG + Intronic
1104939555 12:132388510-132388532 GAGGCAGAGAGGCCTGGAGTGGG + Intergenic
1105775175 13:23653246-23653268 GAGTCAGTGGGGACGAAAGTGGG - Intronic
1105882197 13:24614772-24614794 GAGTGAGTGGCCTCTGGAGTGGG - Intergenic
1105946747 13:25196899-25196921 GGGACAGTGGGACCTGGAGTGGG - Intergenic
1106212892 13:27667179-27667201 GAGTCCCTGGGATCTGGGGTGGG - Intronic
1107871431 13:44749813-44749835 GAGTCACTGGGGTATGGGGCTGG + Intergenic
1108004827 13:45935782-45935804 GAGGCAGTGGGGTTGGGAGAAGG + Intergenic
1109517173 13:63458629-63458651 GAGACACTGGGGTGGGGAGTTGG + Intergenic
1111863466 13:93738644-93738666 GAGACATGGGGGTTTGGAGTAGG + Intronic
1119137673 14:72235373-72235395 GGGACAGTGGGGACTGGAGCTGG + Intronic
1122831971 14:104402632-104402654 GCGTCAGTGTGGTCTGGATGTGG + Intergenic
1124371964 15:29109136-29109158 GAGACACTGCGGGCTGGAGTGGG + Intronic
1125419722 15:39492608-39492630 GAATCGGTGGGCTCTGGAGAAGG + Intergenic
1126336303 15:47589402-47589424 GAGTCAGCAGGGGCTGGAGCAGG - Intronic
1128511274 15:68315494-68315516 GAGGCAGTGGGGTGGGGAGGTGG - Intronic
1129303109 15:74637962-74637984 GGGAGAGTGGTGTCTGGAGTGGG - Intronic
1131301859 15:91206646-91206668 GAATGAGTGGGGTTTGGGGTGGG + Intronic
1131472372 15:92708393-92708415 GAGTCAGCCCGGTCTGGAGGAGG + Intronic
1132581093 16:684967-684989 GGGGCAGTGGGGTCGGGAGGTGG - Intronic
1132607082 16:798141-798163 GTGTGAGTGGGGCCAGGAGTGGG + Exonic
1132607138 16:798348-798370 GAGTGAGTGGGGCCGGGAGTGGG + Exonic
1132607189 16:798522-798544 GAGTGAGTGGGGCCGGGAGTGGG + Exonic
1132714507 16:1284050-1284072 GAGGGAGTGGGGTGTGGAGCTGG + Intergenic
1133111406 16:3550226-3550248 TAGACAGTGGGGGCTGGGGTAGG - Intronic
1133797542 16:9058369-9058391 GAGCAAGTGAGGTCTGAAGTAGG - Intergenic
1135330380 16:21555346-21555368 GCAGGAGTGGGGTCTGGAGTCGG + Intergenic
1136380570 16:29892782-29892804 AAGACAGTGGGGTCTGGAACAGG + Intronic
1136610663 16:31363096-31363118 GGGTGGGTGGGGTCTGGTGTGGG + Intronic
1136929507 16:34406648-34406670 TAGTCTGTGGTTTCTGGAGTTGG - Intergenic
1136975067 16:35005156-35005178 TAGTCTGTGGTTTCTGGAGTTGG + Intergenic
1137944214 16:52718122-52718144 CAGACAGTGGGCTCTGGAGATGG - Intergenic
1138596810 16:58033436-58033458 CATTCAGTGGGGGCTGGAATGGG + Intronic
1139365155 16:66428175-66428197 GAGTCAGCCGGGTGTGGGGTGGG - Intronic
1140212846 16:72984281-72984303 GAGTCACTGGGGAATGGAGGAGG - Intronic
1140507478 16:75482872-75482894 GTGGCTGTGGGATCTGGAGTCGG - Intronic
1141724823 16:85780920-85780942 GATTCAGTGGGGTCTGGGGTGGG + Intronic
1141740990 16:85892861-85892883 GGGTCAGTGAAGGCTGGAGTAGG + Intergenic
1142356231 16:89603484-89603506 GAGGCACTGGGGGCTGGAGGGGG + Intergenic
1143474043 17:7192886-7192908 GAGGCAGTGGGGTGGGGAGAGGG + Intronic
1143648539 17:8248213-8248235 GAGACAGGGGTGTCGGGAGTTGG - Intronic
1146056765 17:29585227-29585249 GACCCAGTGGTGTTTGGAGTGGG - Intronic
1146112661 17:30104621-30104643 GTGTGAGTGGGGTCTGTCGTGGG + Intronic
1146790883 17:35749989-35750011 GGGTTAGTGGGGGCTGGAGTGGG + Intronic
1147867427 17:43562378-43562400 GAGTCACTGGGGTCGGGGGCAGG + Intronic
1147912176 17:43862283-43862305 GACAAGGTGGGGTCTGGAGTGGG - Exonic
1148080723 17:44966698-44966720 GAGTCAGGAGGGGCTGGAGCTGG + Intronic
1148988682 17:51646691-51646713 CAGGCAGGGGAGTCTGGAGTAGG - Intronic
1151444105 17:74152144-74152166 GGCTCAGTGGGGTCAGGAGGTGG - Intergenic
1151850038 17:76684774-76684796 GGGGCAGTGGGGTGTGGAGGGGG + Intronic
1152023722 17:77795475-77795497 GAGTCACTGGGGTCTGGGGAAGG + Intergenic
1152553955 17:81043801-81043823 GAGCCAGAGGGCCCTGGAGTTGG - Intronic
1153464705 18:5376568-5376590 GAGGCAGTGCAGTCTGGATTGGG - Intergenic
1153709546 18:7783939-7783961 GAGTCACAGGGGTTTGGAGTGGG + Intronic
1153934108 18:9905342-9905364 GAGTTCGTGGTGTGTGGAGTAGG + Intergenic
1154344196 18:13528771-13528793 GAGCCAGTGGGGTGTGCAATGGG - Intronic
1155003023 18:21704757-21704779 GAGACACTGTGGTCGGGAGTAGG - Exonic
1155067131 18:22277616-22277638 GAGGCAGTTGGGTCTGGATGTGG + Intergenic
1156318362 18:35993676-35993698 GAGTCTGTGGTGTCTGAAGCAGG + Intronic
1156334280 18:36154378-36154400 GAGTCAGTGGGTTCTGCATGTGG - Intronic
1156578838 18:38351611-38351633 GAGGCAGTGGGATCTGGATAGGG + Intergenic
1156913029 18:42433864-42433886 GGGACAGTGGTGGCTGGAGTTGG + Intergenic
1158588775 18:58762642-58762664 GGGGCAGTGGGGCCTGGAGGAGG - Intergenic
1159662691 18:71118423-71118445 AAGTCAGTGGGGTGGGGAGGAGG - Intergenic
1160240327 18:77118235-77118257 GGGTCAGTGGGTTCGGGAGCAGG + Intronic
1160784321 19:892596-892618 GAGTTATAGGGGTCTGGAGAGGG - Intronic
1161868119 19:6849476-6849498 GAGACAGTGGGGTGGGGGGTGGG + Intronic
1163358565 19:16830503-16830525 GACTCACTGAGGTTTGGAGTGGG + Intronic
1163439282 19:17313393-17313415 CTGTGAGTGAGGTCTGGAGTGGG - Intronic
1163863738 19:19755722-19755744 TGGTCAGTGGGGTCTGGAATTGG - Intergenic
1164586430 19:29478922-29478944 CAGCCAGTGGGGTCTGGGGAAGG - Intergenic
1164982115 19:32621889-32621911 GAGTCAGTGGGGCTTGGAGGTGG - Intronic
1165448390 19:35869033-35869055 GAGTCACCTGGGTCTGGAGAGGG - Intronic
1165811457 19:38614322-38614344 GAGTGTTTGGGGGCTGGAGTGGG + Intronic
1166581769 19:43906987-43907009 GAGGCAGTGGGGTTGGGAGGGGG - Intergenic
1167355200 19:48999376-48999398 GAGTGAGTTGGGTCAGGAATAGG + Intronic
1167795192 19:51704209-51704231 GAGTGAGCGGGGTCGGGAGAGGG + Intergenic
1168254805 19:55159508-55159530 GAGTCAGTGGGGTGGAGGGTGGG - Intronic
925070006 2:959487-959509 GAGTCAGGGAGGCCTGGAGTCGG + Intronic
925376722 2:3391283-3391305 GGGTAAGTGGGTTCAGGAGTGGG - Intronic
925944294 2:8846472-8846494 GTCTCAGTGGGGTCCTGAGTAGG + Intergenic
927853274 2:26513121-26513143 GAGTCAGTGGGCGGTGGGGTTGG + Intronic
928901444 2:36322644-36322666 GAATCAGTGGCTTCTGTAGTTGG + Intergenic
932327037 2:70870133-70870155 GGGTGACTGGGGACTGGAGTAGG + Intergenic
932411340 2:71549691-71549713 CAGGCATGGGGGTCTGGAGTGGG + Intronic
933324260 2:80815505-80815527 GAGACAGGGAGGTCTGGACTGGG + Intergenic
934478006 2:94605691-94605713 GAGGCAGTGGGGCTTGGGGTGGG + Intergenic
934569027 2:95357034-95357056 GAGACAGTGTGGGCTGGAGCTGG + Intronic
934903463 2:98179158-98179180 GAGGCACTGGTGTCTGGAGCTGG - Intronic
935350897 2:102151282-102151304 CCGTCACTGGGGTCTGGAGATGG - Intronic
936012548 2:108934229-108934251 GGGTGAGTGGGGTCTGGGGGAGG + Intronic
936029469 2:109059638-109059660 GAGGCAGTGGTGGCTGGAGTTGG - Intergenic
936697675 2:114969854-114969876 GGGTTAGTGGGGACTGGAGGTGG - Intronic
938943309 2:136188276-136188298 GGGTCACTGAGCTCTGGAGTGGG + Intergenic
939564302 2:143768528-143768550 GAGTGAGTGTGGTTGGGAGTAGG + Intergenic
940648726 2:156418947-156418969 GAGACTGTGGGGTGTGAAGTAGG + Intergenic
941876310 2:170437199-170437221 GAATCAGTGGGGTAGGGAGTGGG - Intronic
942551616 2:177125850-177125872 GAGTCAGTGGGGGATCGGGTGGG - Intergenic
944053304 2:195496000-195496022 GAGTGAGTGGGGTGGGGAGGTGG - Intergenic
945301967 2:208222780-208222802 GAGTTTGTGGGTTCAGGAGTAGG + Intergenic
945850235 2:214997190-214997212 GAGTCAGTGGGAAATGGAGAAGG + Intronic
947834512 2:233165952-233165974 GAGTCAGTGGAGTCAGGAACAGG + Intronic
1168939261 20:1695047-1695069 GGGTCAGTGGAGTTTGGAGAAGG - Intergenic
1168952692 20:1813288-1813310 GGGTCACTGAGGTCAGGAGTTGG + Intergenic
1169201589 20:3712832-3712854 GAGAGAGTGGGGTGTGGATTTGG - Intergenic
1169646576 20:7817079-7817101 GATTTAGTAGGGTCTGGAGAGGG + Intergenic
1169980543 20:11379581-11379603 GAGTCTGTGCATTCTGGAGTTGG - Intergenic
1170220365 20:13935620-13935642 GAGTGAGTGGGGTGGGGAGAGGG + Intronic
1170314334 20:15027109-15027131 GTGTCAGTGGGGGTAGGAGTGGG + Intronic
1171016808 20:21549323-21549345 GAGACAGTGGTGTGTGGAGTTGG - Intergenic
1172506630 20:35467517-35467539 GAGTCAAGGGGATCTGGAGAAGG + Exonic
1172510497 20:35497636-35497658 GATTGAGTGGGGTCTGGCCTGGG + Intronic
1173184227 20:40828376-40828398 GAGTCATTGGGTTCTGGTGAGGG - Intergenic
1173201925 20:40960836-40960858 GAGTCAACGGGGCCTGGCGTGGG - Intergenic
1173470361 20:43318950-43318972 GAGTCAATGGGGATTGGCGTGGG - Intergenic
1173500394 20:43548783-43548805 GAGCCAGTGGGGTCTGGCTGGGG - Intronic
1173852545 20:46228111-46228133 GAATCAGTAGGAGCTGGAGTGGG - Intronic
1174449223 20:50609477-50609499 GGGCCAGTGGGGGCTGGAGGAGG - Intronic
1175312980 20:58024608-58024630 GGGTCAGTGGGAGCTGGAGAGGG - Intergenic
1176149335 20:63581343-63581365 GAGATGTTGGGGTCTGGAGTGGG + Intergenic
1176421689 21:6521188-6521210 GGGTCAGTGGGGTGTGGTGTAGG + Intergenic
1178894130 21:36544575-36544597 GAGTGAGTGTGCTCTGGAGGAGG - Intronic
1179697179 21:43129504-43129526 GGGTCAGTGGGGTGTGGTGTAGG + Intergenic
1182459897 22:30476159-30476181 CAGCCAGTGGGGTCAGGAGGAGG + Intergenic
1183171426 22:36191128-36191150 GAGGCAGTGGGCTCAGGAGCTGG - Exonic
1183280506 22:36929609-36929631 GAGACAGTGGGTGCTGGAGGAGG - Intronic
1183991304 22:41598691-41598713 CAGGCAGAGGGGTCTGGAGCAGG + Exonic
1184345149 22:43908688-43908710 CAGTCAGTGTGGTGTGGACTTGG + Intergenic
1184876162 22:47277099-47277121 GAGTCAGTGGGGTGAGCAGCAGG + Intergenic
949525417 3:4898524-4898546 CAGTCAGTGGTGGCTGAAGTAGG - Intergenic
950153984 3:10708466-10708488 GAGTGAATTGGGTGTGGAGTAGG + Intergenic
950202425 3:11054816-11054838 GGGTCTGCGGTGTCTGGAGTGGG + Intergenic
950500124 3:13358465-13358487 GAGTCAGAGGGAGCTGGGGTGGG - Intronic
951809226 3:26681037-26681059 GAATTATTGTGGTCTGGAGTAGG + Intronic
952937755 3:38413499-38413521 GAGACTGTGGGGTTTGGATTGGG - Exonic
953635309 3:44658489-44658511 GAGTCAGTGGGTTCTGCCATAGG + Intronic
953733669 3:45472324-45472346 GTGTCAGTGGGGAAGGGAGTGGG + Intronic
953758688 3:45669575-45669597 GTGGGAGTGGGGTCTTGAGTGGG - Intronic
954733611 3:52686104-52686126 TAGTAAGTGGGGTCGGGAGGCGG + Exonic
955413335 3:58670132-58670154 CAATCAGTGGGGTCTGGCATTGG + Intergenic
957778042 3:84781389-84781411 AAGTCAGTGGGATTTTGAGTAGG - Intergenic
959772092 3:110110382-110110404 GAGACTGTGGTGTCTGGAGTGGG - Intergenic
962870841 3:139491632-139491654 GAGCTAGTAGGGTCTGGAATTGG + Intergenic
963083465 3:141415838-141415860 AGGTCAGTGGGGGCTGGAGATGG - Intronic
964548871 3:157865015-157865037 GAAGCAGGGAGGTCTGGAGTTGG + Intergenic
965953870 3:174344516-174344538 GAGTCAGGGGAGGCTGGAGAGGG - Intergenic
966934457 3:184696806-184696828 GAGTAAGTGGGGGGTGGGGTCGG - Intergenic
967979754 3:195058735-195058757 GAGTCAGTGGAGTCAGGTGCAGG + Intergenic
968547646 4:1206935-1206957 GAGGCAGTGGGGGCAGGTGTGGG + Intronic
969192476 4:5533400-5533422 GAGCCAGTGGGGGGTGGAGTGGG + Intergenic
969722644 4:8901065-8901087 GGGTCAGGGGGTTCTGGTGTAGG - Intergenic
970463276 4:16297183-16297205 AAGCCAATGGGATCTGGAGTGGG - Intergenic
971714939 4:30164275-30164297 CTGTCACTGGGTTCTGGAGTTGG - Intergenic
977326845 4:95584681-95584703 GTGTCAGTGGTGGCAGGAGTGGG + Intergenic
977678690 4:99774772-99774794 AAGAAAATGGGGTCTGGAGTGGG + Intergenic
981396625 4:144257239-144257261 GAACCAGTGGGGACTGGAGAAGG - Intergenic
983160436 4:164407225-164407247 AAGTCAGTTGTGTCTAGAGTAGG - Intergenic
984717681 4:182940747-182940769 GAGCCAGTGGGGGCTGGAGGAGG + Intergenic
986032360 5:3906077-3906099 GAGTCAGTAGGCTCTGAAGAAGG - Intergenic
986043156 5:4012380-4012402 GAGGCAGAGGGTTCTGGAGGAGG + Intergenic
986061154 5:4192311-4192333 GCATCAGTGAGGTCTGGAGAAGG - Intergenic
987117591 5:14738018-14738040 AAGTCAGAGGGGTGTAGAGTAGG - Intronic
987999499 5:25330742-25330764 GAGTCCGTGGGGGCAGGAGGTGG - Intergenic
989190656 5:38666825-38666847 GAGTCAGTGGGGCCTGGGCCAGG + Intergenic
990269039 5:54114974-54114996 GAAACAGTGGGGACTGCAGTTGG + Intronic
992177569 5:74165366-74165388 GATTCAGTGGGGTCTGGAGAGGG + Intergenic
993143908 5:84070101-84070123 GAGCCAGGAGGGTATGGAGTGGG - Intronic
994137668 5:96306394-96306416 AAGTCAGTGAGGCCAGGAGTTGG - Intergenic
995968081 5:117933766-117933788 GAGGGAGTGGAGCCTGGAGTAGG - Intergenic
996772708 5:127101754-127101776 GAATAAGTGGGGCTTGGAGTGGG - Intergenic
997236956 5:132278154-132278176 GAGACAGTGGCGTCTGGACTGGG - Intronic
997460341 5:134047500-134047522 GAGTCCCTGGGGTCTGGAGTTGG - Intergenic
997467203 5:134096209-134096231 GTGTCAGTGGGGCCTGGGGAGGG - Intergenic
998067847 5:139172913-139172935 GCATCAGCGGGTTCTGGAGTGGG - Intronic
998760774 5:145429484-145429506 GAGTTAGTGAGATATGGAGTAGG + Intergenic
1000394322 5:160757674-160757696 GAGTCAGTGTGGTATGGATGGGG + Intronic
1001225664 5:169942646-169942668 GATGCAGGGCGGTCTGGAGTTGG + Intronic
1002583368 5:180224467-180224489 GGGTGAGTGGGACCTGGAGTGGG + Intergenic
1003153920 6:3575192-3575214 GAGTCTGTGGGGGCTGCAGCTGG - Intergenic
1005290511 6:24374615-24374637 GAGGAGGTGGGGTCTGGAGCTGG + Intergenic
1006171930 6:32098041-32098063 CACACAGTGGGGGCTGGAGTGGG - Intronic
1006750244 6:36372522-36372544 GAGGCAATGGGGGCTGGAATGGG + Intronic
1007341520 6:41194039-41194061 GGGTCAGTGGGGAGCGGAGTTGG - Intronic
1007747385 6:44051449-44051471 GAGACAGTGGGGCCTGGGGTAGG + Intergenic
1011150905 6:84272275-84272297 GTGTCAGTGGGATATGTAGTGGG + Intergenic
1011486472 6:87846986-87847008 AAGTCAGTGGGATTTGGATTGGG - Intergenic
1013084147 6:106841188-106841210 CAGTCACTGGGGGCTAGAGTCGG - Intergenic
1014810763 6:125882875-125882897 GAGTTAGTGGGTAGTGGAGTTGG - Intronic
1015091575 6:129364923-129364945 GAGGAAGTGGGGGCTGGAGGTGG + Intronic
1015481929 6:133721749-133721771 TAGTCAATAGGGTCAGGAGTTGG + Intergenic
1016790760 6:148064822-148064844 GAGTCTGGGTGGTCTGGACTGGG - Intergenic
1017013297 6:150079687-150079709 GGCACAGTGGGGTCTGGAGCAGG - Intergenic
1017149658 6:151267549-151267571 GAGAGGGTGGGGTGTGGAGTAGG + Intronic
1017442254 6:154475180-154475202 AAGACAATGGGTTCTGGAGTCGG - Intronic
1018604236 6:165579968-165579990 GAGTGAGGAGGGTCAGGAGTTGG - Intronic
1018698713 6:166410747-166410769 AAGTCAGTGGGTTCTGGTGCAGG - Intronic
1018740591 6:166725643-166725665 GAGCCAGTGGGGGGTGGGGTGGG + Intronic
1019718518 7:2554481-2554503 GAGCGAGCTGGGTCTGGAGTGGG - Intronic
1021796822 7:24263837-24263859 GAGGCAGTGTGGCCTGGAGCAGG - Intergenic
1023684789 7:42723201-42723223 TAGTCAGTGGGGACTGTTGTTGG + Intergenic
1023984819 7:45088462-45088484 GAGGCAGCGGGTTCTGGAGGCGG - Intronic
1024556056 7:50604502-50604524 GGGTCAGTGGGGTCTTCAGATGG - Intronic
1026496769 7:70910380-70910402 GAGACAGTGGTGGCTTGAGTTGG - Intergenic
1026746454 7:73016973-73016995 AAGTCAGCGGGGTTTGGTGTTGG + Intergenic
1026750105 7:73045116-73045138 AAGTCAGCGGGGTTTGGTGTTGG + Intergenic
1026753753 7:73073226-73073248 AAGTCAGCGGGGTTTGGTGTTGG + Intergenic
1026757404 7:73101262-73101284 AAGTCAGCGGGGTTTGGTGTTGG + Intergenic
1027032557 7:74901531-74901553 AAGTCAGCGGGGTTTGGTGTTGG + Intergenic
1027090000 7:75292224-75292246 AAGTCAGCGGGGTTTGGTGTTGG - Intergenic
1027093645 7:75320152-75320174 AAGTCAGCGGGGTTTGGTGTTGG - Intergenic
1027097288 7:75348119-75348141 AAGTCAGCGGGGTTTGGTGTTGG - Intergenic
1027322059 7:77019553-77019575 AAGTCAGCGGGGTTTGGTGTTGG + Intergenic
1027325693 7:77047473-77047495 AAGTCAGCGGGGTTTGGTGTTGG + Intergenic
1027955951 7:84880243-84880265 GTGTGTGTGGGGTGTGGAGTGGG + Intergenic
1028346823 7:89793532-89793554 GAGTCAGAGGGGGATGGATTAGG + Intergenic
1029479347 7:100803335-100803357 GAGCCCGTGGGGTGAGGAGTTGG - Exonic
1029582640 7:101447618-101447640 GCAGCAGTGGGGTCTGGAGGTGG + Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1034264637 7:149774955-149774977 GAGACCGAGGGGTGTGGAGTCGG + Intergenic
1034348242 7:150399927-150399949 GACTCAGTGAGGCCTGAAGTGGG - Intronic
1034446328 7:151115870-151115892 GAGTCAGAGGGCTCTGGGCTAGG + Intronic
1035123128 7:156585535-156585557 GAGCCAGAGGGGGCTGGAGATGG - Intergenic
1035324456 7:158055985-158056007 CAGGCAGTGGGGTCTGGAACAGG - Intronic
1035336082 7:158127671-158127693 AATCCAGTGGGGTCTGGGGTAGG + Intronic
1035353742 7:158265013-158265035 GGGGCTGTGGGGCCTGGAGTAGG - Intronic
1035780106 8:2221459-2221481 GGGTCAGTTGGGTCAGGAGGAGG + Intergenic
1037763070 8:21755052-21755074 GAGTCAGTGGGGAGTGGGGGAGG + Intronic
1038056365 8:23861992-23862014 GAGTGAGTGGGGGAAGGAGTTGG - Intergenic
1039715048 8:40099067-40099089 CACTCAGTGGGGACGGGAGTTGG + Intergenic
1039923183 8:41907136-41907158 GAGGGAGTGGGGTGTGGAGTGGG + Intergenic
1040490684 8:47919041-47919063 GGGGCAGTGGGGTGTTGAGTCGG - Intronic
1041914718 8:63127466-63127488 GGCTCAGAGGGGTCTGGAATAGG - Intergenic
1042094387 8:65197066-65197088 TAGTCAGTGGGTTCTGGAGCTGG + Intergenic
1043859576 8:85300281-85300303 CTGTCAGTGGGGTATGGGGTAGG + Intergenic
1045504269 8:102767527-102767549 GAGTCACTGGGGCATGGGGTGGG + Intergenic
1045845823 8:106634940-106634962 GATTCAGTAGGGTCTGGGGAGGG - Intronic
1047105280 8:121724685-121724707 GAGTCACTTGGGACTGAAGTAGG + Intergenic
1047248864 8:123166732-123166754 GATTCCGTGGGGTATGGGGTGGG - Intergenic
1048603413 8:135943028-135943050 GGGTCAGTGGAGTCTGGTTTCGG - Intergenic
1049509144 8:143018936-143018958 GAGCCAGGAGCGTCTGGAGTTGG - Exonic
1049616674 8:143578536-143578558 GAGGCCGTTGGGCCTGGAGTGGG - Exonic
1049664517 8:143837052-143837074 GAGTCAAAGGGCTCTGGCGTCGG + Exonic
1050122778 9:2325038-2325060 CAGTCAGTGCGGTCAGAAGTGGG - Intergenic
1052314734 9:27104765-27104787 GAGTAAATGGGGTTTGGAGAGGG + Intergenic
1055107449 9:72527542-72527564 GAGTCACTGGGGTCTGGGGAGGG - Intronic
1056101544 9:83304871-83304893 GATCCCCTGGGGTCTGGAGTAGG + Intronic
1056163497 9:83921147-83921169 GCGTCCGAGGGGTCTGGGGTCGG - Intronic
1056288316 9:85114072-85114094 GGGTCAGTGGGGTGTCAAGTAGG - Intergenic
1056905320 9:90642615-90642637 GAGTCAGCGTGTACTGGAGTTGG - Intronic
1057484122 9:95468832-95468854 GAGGCAGTGGAGGCTGGAGTCGG + Exonic
1058927758 9:109684355-109684377 GATTCAGAGGGGTCTAGAGTGGG - Intronic
1058950436 9:109898700-109898722 GAGTCAGTGGAGTTTGGGATGGG - Intronic
1059350085 9:113658325-113658347 TAATGAGTGGGGCCTGGAGTAGG + Intergenic
1059409314 9:114122209-114122231 GACTCATTGGGGTTTGGAGTGGG + Intergenic
1061220634 9:129248476-129248498 GAGTCTGTGGGGTCTTGATATGG + Intergenic
1061375382 9:130220886-130220908 GAGGAGGTGGGGGCTGGAGTTGG + Intronic
1062196733 9:135278349-135278371 AAGTCAGTGGGGGCTGGTGCGGG + Intergenic
1062565259 9:137161473-137161495 GAGTGGGTGGGGCATGGAGTAGG + Intronic
1187486461 X:19708691-19708713 GAGTCGCAGGGGTCAGGAGTGGG - Intronic
1187959102 X:24551173-24551195 GAGGCACTGGGTTCTGGTGTCGG - Intergenic
1189707917 X:43778215-43778237 GAGACAGTGGGGGATGGGGTAGG + Intronic
1190126330 X:47708849-47708871 TATGCAGTGGGGTCTGCAGTTGG + Intergenic
1192795394 X:74421280-74421302 GAGGCAGTGGCGGCTGGAGTAGG + Intergenic
1195105299 X:101597670-101597692 CTAACAGTGGGGTCTGGAGTGGG - Intergenic
1195107583 X:101616097-101616119 CTAACAGTGGGGTCTGGAGTGGG + Exonic
1195450280 X:105003788-105003810 GAGTGTGTGGGGCCTGGAGGTGG - Intronic
1196814670 X:119655354-119655376 GAGTCACTGGGGCCTGGGGGTGG - Intronic
1198764340 X:140065446-140065468 GAGGCAGTGGGGTCGGGGGTTGG - Intergenic
1201603640 Y:15760621-15760643 CAGTCAATGAGGGCTGGAGTTGG - Intergenic