ID: 1085736735

View in Genome Browser
Species Human (GRCh38)
Location 11:79045570-79045592
Sequence CTCCAGTAGCAGCCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085736735_1085736742 7 Left 1085736735 11:79045570-79045592 CCCTGGCCTGGCTGCTACTGGAG 0: 1
1: 0
2: 3
3: 54
4: 294
Right 1085736742 11:79045600-79045622 TGCAGAGGAGCCCGGCTTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 288
1085736735_1085736740 -1 Left 1085736735 11:79045570-79045592 CCCTGGCCTGGCTGCTACTGGAG 0: 1
1: 0
2: 3
3: 54
4: 294
Right 1085736740 11:79045592-79045614 GCTCAGGCTGCAGAGGAGCCCGG 0: 1
1: 0
2: 3
3: 115
4: 1457
1085736735_1085736741 4 Left 1085736735 11:79045570-79045592 CCCTGGCCTGGCTGCTACTGGAG 0: 1
1: 0
2: 3
3: 54
4: 294
Right 1085736741 11:79045597-79045619 GGCTGCAGAGGAGCCCGGCTTGG 0: 1
1: 0
2: 2
3: 25
4: 345
1085736735_1085736739 -8 Left 1085736735 11:79045570-79045592 CCCTGGCCTGGCTGCTACTGGAG 0: 1
1: 0
2: 3
3: 54
4: 294
Right 1085736739 11:79045585-79045607 TACTGGAGCTCAGGCTGCAGAGG 0: 1
1: 0
2: 1
3: 40
4: 642
1085736735_1085736746 20 Left 1085736735 11:79045570-79045592 CCCTGGCCTGGCTGCTACTGGAG 0: 1
1: 0
2: 3
3: 54
4: 294
Right 1085736746 11:79045613-79045635 GGCTTGGAGGCAGGCAGCCACGG 0: 1
1: 0
2: 5
3: 83
4: 723
1085736735_1085736743 11 Left 1085736735 11:79045570-79045592 CCCTGGCCTGGCTGCTACTGGAG 0: 1
1: 0
2: 3
3: 54
4: 294
Right 1085736743 11:79045604-79045626 GAGGAGCCCGGCTTGGAGGCAGG 0: 1
1: 1
2: 7
3: 40
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085736735 Original CRISPR CTCCAGTAGCAGCCAGGCCA GGG (reversed) Intronic
900543568 1:3216325-3216347 CTCCAGTGACATCCATGCCACGG + Intronic
901023131 1:6265075-6265097 GTCCAGTAGCAAACAGGCCCTGG - Intronic
901463247 1:9404280-9404302 CTGCAGGAGCAGCCAGGATATGG + Intergenic
902271499 1:15308358-15308380 CCCCAGTGGCAGCCAGGCCTGGG + Intronic
902398736 1:16146045-16146067 TTCCAGCAGCAGCATGGCCAGGG + Intronic
902456855 1:16539539-16539561 CTCCCGCAGCAACCAGGCCAGGG - Intergenic
902474377 1:16673476-16673498 CTCCTGCAGCAACCAGGCCAGGG - Exonic
902484426 1:16733966-16733988 CTCCTGCAGCAACCAGGCCAGGG + Exonic
902495314 1:16868374-16868396 CTCCCGCAGCAACCAGGCCAGGG + Intronic
905030115 1:34876616-34876638 CGCCTGCAGCAGACAGGCCAGGG + Intronic
905347838 1:37323478-37323500 CTCCATTACCACCCTGGCCATGG + Intergenic
905601305 1:39254172-39254194 TTACAGTAGAAGCCAGGCCTGGG - Intronic
906113406 1:43339284-43339306 CCCCAGTATCATCAAGGCCATGG + Exonic
907280948 1:53346756-53346778 ATCAAGGAGGAGCCAGGCCAGGG - Intergenic
907306075 1:53513838-53513860 CCCCAGGCGCAGGCAGGCCATGG + Intronic
907733054 1:57086423-57086445 GTCCAGCTGCAGCCTGGCCAGGG - Intronic
908461090 1:64348830-64348852 CTGCAGCAGCCCCCAGGCCATGG + Intergenic
911618189 1:100037983-100038005 CTACAGTAGCCGCGCGGCCAGGG - Intergenic
913662104 1:121013182-121013204 CTCCCATAGCAACCAGGCCAGGG - Intergenic
913970048 1:143407999-143408021 CTACACTAGGAGCCAGCCCAGGG + Intergenic
914013478 1:143796367-143796389 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914064422 1:144233596-144233618 CTACACTAGGAGCCAGCCCAGGG + Intergenic
914114728 1:144732758-144732780 CTACACTAGGAGCCAGCCCAGGG - Intergenic
914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG + Intergenic
914652103 1:149704976-149704998 CTCCCATAGCAACCAGGCCAGGG - Exonic
916681829 1:167111974-167111996 GCCCAGTGTCAGCCAGGCCATGG + Intronic
918943027 1:191026410-191026432 CTCCAGCCTCAGCCAGCCCAGGG + Intergenic
920195403 1:204223193-204223215 CTCCAGAAGCAGGCAGGGAATGG - Intronic
920751890 1:208686126-208686148 CTCCACTAGCAGGCTGGCCTGGG + Intergenic
920789699 1:209078126-209078148 CCCCATTAGCAGCTAGGGCATGG - Intergenic
922915299 1:229252501-229252523 CACCAGTTGCAGCCTGGGCAGGG - Intergenic
924111197 1:240701492-240701514 CTCCAGTACCAGGCCGGGCATGG - Intergenic
1064137952 10:12766720-12766742 CTCCTGCTGAAGCCAGGCCAAGG - Intronic
1064378137 10:14815465-14815487 GTCCAGAAGTAGCCAGTCCAGGG - Intergenic
1065971943 10:30812565-30812587 CTGGGGAAGCAGCCAGGCCAGGG - Intergenic
1066440713 10:35436100-35436122 CAGCAGCAGCAGCCAGGCCATGG + Intronic
1067019084 10:42779662-42779684 CACCTGCAGGAGCCAGGCCAGGG + Intergenic
1067234672 10:44437596-44437618 CTCCAGTACCAGCCAGGCCCTGG - Intergenic
1069532507 10:69229654-69229676 CTTCAGAAGCAGCCAGGGCCAGG - Intronic
1069959670 10:72072395-72072417 CTCCTTGAGCAGCCAGGCCCCGG - Intronic
1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG + Intronic
1071337418 10:84612265-84612287 CTCAGGTAGCAGCCAAGCCAGGG - Intergenic
1072691933 10:97577831-97577853 CTCCAGCACCAGCAAGTCCATGG - Exonic
1074722172 10:116272790-116272812 CTCCAGAGGCCGCCAAGCCAGGG + Intronic
1075444816 10:122505895-122505917 CTCCAGGGTCACCCAGGCCAAGG - Intronic
1076268394 10:129129281-129129303 CTCCAGAAGGAGCCAGGCTCTGG - Intergenic
1077530009 11:3090630-3090652 CTCCGGCCACAGCCAGGCCACGG - Exonic
1078592581 11:12657530-12657552 CACCAGTAGCAACTAGGCAATGG + Intergenic
1081806035 11:45891032-45891054 GTCCATCAGGAGCCAGGCCAAGG - Intronic
1082870369 11:57938850-57938872 CTCCAGTGGCCTCCAGGGCAAGG + Intergenic
1083234041 11:61340686-61340708 CTCCTGTACCTGCCAGGCTATGG + Intronic
1083266248 11:61548247-61548269 CTGCACCAGCAGGCAGGCCAGGG - Intronic
1083946244 11:65924698-65924720 GTCCAGCAGCACCCAGGGCAGGG - Intergenic
1084044346 11:66560193-66560215 CTCCAGTTGCAGCCGGTCAATGG - Exonic
1084101279 11:66951312-66951334 CTGCAGGAGCAGCCGAGCCAGGG - Intronic
1084315578 11:68343508-68343530 CCACAGGAGCAGCCAGGGCATGG + Intronic
1084557159 11:69882001-69882023 CCCCAGCAGCAGCCTGGCCAGGG - Intergenic
1084860709 11:72016056-72016078 CTCCAACCTCAGCCAGGCCAAGG - Exonic
1085276960 11:75306662-75306684 AGGCAGCAGCAGCCAGGCCAGGG + Intronic
1085736076 11:79040397-79040419 CTCCAGGAGCAGCCAGCCTCCGG + Intronic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1087182954 11:95157476-95157498 CTCCAGGAGCTGCTGGGCCAGGG + Intergenic
1087515451 11:99154277-99154299 CACCAGTGGCAGCCATGGCACGG + Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1091288891 11:134425832-134425854 CACCTGTTGCAGCCTGGCCACGG - Intergenic
1091315641 11:134612016-134612038 CTCCATCATCAGCCATGCCAGGG - Intergenic
1091339409 11:134798674-134798696 CTCCAGGAGCTGGCCGGCCAGGG - Intergenic
1091409947 12:232800-232822 TTCCAGAAGCAGACAGACCATGG - Intronic
1091545701 12:1500206-1500228 CTCCCGCAGCAGCCAGGCCCGGG + Intergenic
1094296680 12:28914783-28914805 TTGCAGGAGCAGCCAGGCAAGGG - Intergenic
1096539637 12:52298294-52298316 CTACAGTGGGAGCCAGTCCAAGG - Intronic
1096571903 12:52528362-52528384 CTCTAGGAGCAGCCAGACCTGGG - Intergenic
1097541057 12:60943969-60943991 CTCCAGCAGTAGGCAGGCAACGG + Intergenic
1099730108 12:86489592-86489614 CCACAGTAGCATCCAGGTCAGGG - Intronic
1100210750 12:92396207-92396229 CTCAAGGTGCAGCCAGCCCAGGG + Intergenic
1100980056 12:100156688-100156710 CTCCAGGAGCACCCAGGCTTGGG - Intergenic
1101538401 12:105641816-105641838 GTCCAGAAGGAGGCAGGCCAGGG + Intergenic
1101753134 12:107599734-107599756 CTCCAGTATCGGCCAGGCACTGG - Intronic
1102013240 12:109631785-109631807 CTCCCGTAGCAGACAGGGCCTGG - Intergenic
1102013410 12:109632698-109632720 CTCCTGTAGCAGACAGGGCCTGG + Intergenic
1103354917 12:120312546-120312568 CACCATCAGGAGCCAGGCCATGG - Exonic
1104300674 12:127562471-127562493 ATCCTGTAGCATCCATGCCATGG + Intergenic
1104356777 12:128093832-128093854 CTCCAGAATCAGCCAGGCCTAGG + Intergenic
1105626181 13:22115130-22115152 CTCGAGGAGCATGCAGGCCAAGG - Intergenic
1107293217 13:38880724-38880746 CTCCAGCAGCAGTGAGCCCATGG + Exonic
1108256963 13:48620170-48620192 GTCCACTAGCAGCCTTGCCAGGG - Intergenic
1108734544 13:53269016-53269038 CTCCAGTATCAGCAAGGATATGG - Intergenic
1108905478 13:55466279-55466301 CAACAGTAGCAGCAAGGCAAGGG - Intergenic
1109450915 13:62512959-62512981 CTGCAGGAGCAGCCAGGCAGGGG + Intergenic
1112006134 13:95255329-95255351 CTCCCCTTGGAGCCAGGCCATGG - Intronic
1113405057 13:110031352-110031374 CTCCAAATGCAGCCACGCCAGGG + Intergenic
1113523244 13:110955066-110955088 CACCTGCAGCAGCCAGTCCAGGG + Intergenic
1114881353 14:26789930-26789952 CTCCAGTAACAACTAGGCTAGGG - Intergenic
1116330809 14:43595695-43595717 CTCCAGGAGCAGCCTGGCCCAGG - Intergenic
1117278439 14:54213359-54213381 CTGAAGTGGCAGCCAGCCCATGG + Intergenic
1118181020 14:63493369-63493391 ATCTAGTGGCAGACAGGCCAGGG - Intronic
1118197111 14:63637651-63637673 CTCCAGTCTCATCCAGGTCATGG - Intronic
1118495602 14:66305382-66305404 CTGAAGAAGCAGCAAGGCCAAGG - Intergenic
1121098534 14:91234099-91234121 CTCCAGGACCGGCCGGGCCAGGG - Exonic
1122408180 14:101512602-101512624 CACCATCAGCAGCCAGGCCCGGG - Intergenic
1122413277 14:101536777-101536799 CTCCAGGAGCTCCCAGCCCATGG + Intergenic
1122835410 14:104428388-104428410 CTCAAGGAGCCCCCAGGCCAGGG - Intergenic
1123038304 14:105480245-105480267 CCCCACTAGCAGCCAGGCCCAGG - Intergenic
1202946009 14_KI270726v1_random:27564-27586 CTCCAGCACCAGCCATGGCATGG + Intergenic
1123833351 15:24164301-24164323 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123840079 15:24239380-24239402 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123853023 15:24379895-24379917 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123868981 15:24552463-24552485 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG + Intergenic
1124269604 15:28268520-28268542 CTCCAGTAGCAGCCAAGGCTAGG + Exonic
1127104053 15:55594351-55594373 GTTCAGTAGATGCCAGGCCAAGG - Intergenic
1128452252 15:67812302-67812324 CTGCAGGGGGAGCCAGGCCAGGG + Intergenic
1129656436 15:77528094-77528116 CTCCCCCAGCAGACAGGCCAAGG - Intergenic
1132690650 16:1180554-1180576 CTGCAGTCACAGCCAGGCCGTGG + Intronic
1136403794 16:30031758-30031780 CTCCTGCAGCAGACAGGACATGG - Intronic
1136417911 16:30114560-30114582 CTCCAGCTTCAGGCAGGCCAAGG - Exonic
1136666835 16:31819680-31819702 GCCCAGGAGCAGCCAGGCCCAGG - Intergenic
1137700405 16:50493896-50493918 TTCCAGTGGGAGCCAGGCCCTGG - Intergenic
1142182703 16:88678959-88678981 CTCCAGCAGAATCCAGGGCAGGG + Intronic
1143116898 17:4586043-4586065 CACCAGTAGCAGCAAGCCCCAGG - Intronic
1143880553 17:10026520-10026542 ACCCAGAAGCAGCCAGGGCATGG + Intronic
1144671426 17:17134696-17134718 CTCCAGAAGCAGGAAGGCCATGG - Intronic
1145235536 17:21205453-21205475 CTGCAGGAGGAGGCAGGCCAGGG + Intronic
1145347246 17:22048888-22048910 CTCAAGTAGCATCAAGGCCAAGG - Intergenic
1147350106 17:39835573-39835595 CGCCAACCGCAGCCAGGCCAAGG - Intronic
1147703047 17:42407912-42407934 CTCCAGTAGCAGGCAGGGTAAGG - Intronic
1147837773 17:43347238-43347260 CTCCAGTACCTGCCACCCCAGGG - Intergenic
1147864645 17:43544619-43544641 TTGCAGAAGCCGCCAGGCCAAGG - Intronic
1147870209 17:43581829-43581851 CTCCAGTAAGTGCCAGGCCTGGG - Intergenic
1148092511 17:45031092-45031114 CTCCTGCCCCAGCCAGGCCAGGG - Intronic
1148103167 17:45105048-45105070 CTCCAGCAGAAACCGGGCCATGG + Intronic
1148131773 17:45266606-45266628 CTCCTGGAGCAGCCAGGCCGAGG - Exonic
1148972934 17:51500110-51500132 CTGCAAGGGCAGCCAGGCCAAGG - Intergenic
1149555236 17:57568906-57568928 CCCCGGTACCAGCCAGGCCCAGG - Intronic
1151210409 17:72540236-72540258 CTGCAGGACCATCCAGGCCAGGG + Intergenic
1151703211 17:75754067-75754089 CCCCAGTTTCAGCCAGGCCCGGG + Intronic
1151716580 17:75834247-75834269 CTCCAGCAGCACCTGGGCCAAGG - Intronic
1151728303 17:75896917-75896939 CTCCAGCAGCTGCGCGGCCATGG + Exonic
1151965007 17:77426548-77426570 TTCCAGGAGCAGCCAGGCCAGGG - Intronic
1152944122 17:83189817-83189839 CTCCAGCAGCAGGCAGGCTCCGG - Intergenic
1153528159 18:6016915-6016937 ATGGAGAAGCAGCCAGGCCAGGG + Intronic
1153636533 18:7117804-7117826 CTCCAGGAGCGGCGGGGCCAGGG - Exonic
1154370624 18:13758920-13758942 CTCCAGGAACAGAGAGGCCAAGG + Intronic
1155152982 18:23136546-23136568 TCCCTGGAGCAGCCAGGCCAGGG + Exonic
1157139493 18:45091323-45091345 CTCCAGTGTCAGCCAAGCAAGGG + Intergenic
1157440434 18:47707501-47707523 CTCCTGTTACATCCAGGCCAGGG - Intergenic
1158652665 18:59301462-59301484 CTCCAGAAGCAGCCATGCTCTGG - Intronic
1158953353 18:62517944-62517966 TTCCAGTGGCATCCAGGACATGG + Intergenic
1159619751 18:70623508-70623530 CCCCAGTATCAGCCACACCAAGG - Intergenic
1160197786 18:76770921-76770943 CTTCACTTGCAGCCCGGCCACGG + Intergenic
1160914914 19:1491732-1491754 CTACTGTTGCAGCCAGGCCGGGG - Intronic
1160961807 19:1725509-1725531 CTCCCCCAGCACCCAGGCCAGGG - Intergenic
1161389390 19:4013361-4013383 CTCCAGTCGCAGCCTCCCCAGGG - Intronic
1161771865 19:6235314-6235336 CACCAGCAGGAGCCTGGCCACGG + Intronic
1162208810 19:9075688-9075710 CTCGGGTAGCAGCCAGGCCCAGG - Intergenic
1162802281 19:13118220-13118242 CTGCCGCCGCAGCCAGGCCAGGG - Intronic
1162904981 19:13817990-13818012 CTTCAGCAACAGCCAGGCCTAGG - Intronic
1162932140 19:13962589-13962611 CTCCAGCCTCAGCCAGGGCAGGG - Exonic
1163045449 19:14638269-14638291 CTCCAGCAGCATCCAGGTGAAGG + Exonic
1163059688 19:14751600-14751622 CTCCAGCAGCATCCAGGTCAAGG + Exonic
1163117687 19:15198105-15198127 CTCCAGAAGCAGCCAGCGCTGGG + Intronic
1163265427 19:16217817-16217839 CTCCAGCCTAAGCCAGGCCAGGG - Intronic
1163715151 19:18869002-18869024 CACCAGCAGCAGCGAGGCCTCGG + Exonic
1165758500 19:38307692-38307714 CTCCAGGGTCAGCCAGGCCAGGG + Exonic
1166340780 19:42135361-42135383 CTTCAGCAGCGCCCAGGCCAGGG + Intronic
1166569375 19:43784176-43784198 CTCCAGCTGCGGCCATGCCATGG + Intergenic
1168348118 19:55660626-55660648 CTCTGGGAGCAGCCTGGCCAGGG - Intronic
1168387683 19:55979415-55979437 CTCCATCTGCTGCCAGGCCATGG + Exonic
1202707754 1_KI270713v1_random:35880-35902 CTCCTGCAGCAACCAGGCCAGGG - Intergenic
924987055 2:281610-281632 CTCCAGCAGCAGCCAGCGGAGGG + Intronic
925097901 2:1222512-1222534 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097913 2:1222582-1222604 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097926 2:1222652-1222674 CTCCACCAGCAGGCAGGACAGGG - Intronic
925097936 2:1222722-1222744 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097948 2:1222792-1222814 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097960 2:1222862-1222884 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097973 2:1222932-1222954 CTCCACCAGCAGGCAGGACAGGG - Intronic
925097985 2:1223002-1223024 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925097997 2:1223072-1223094 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925098009 2:1223142-1223164 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925098021 2:1223212-1223234 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925098031 2:1223282-1223304 CTCCAGCAGCAGGCAGGACAGGG - Intronic
925877046 2:8320417-8320439 CTGCAGTGGCAGCCAAGCAATGG + Intergenic
926043267 2:9691631-9691653 TCCCAGTGGCAGCCAGGCCTGGG - Intergenic
926707011 2:15844139-15844161 CTCAAGTGCCAGGCAGGCCAAGG + Intergenic
927710587 2:25323304-25323326 CTCCAGGAACAGCAAGACCAGGG - Intronic
928286056 2:29990911-29990933 CTCCAACAGCAGCCAGGAAAGGG + Intergenic
929992879 2:46804281-46804303 CTCCAAGAGCAGTCAGGCCGGGG + Intergenic
932746155 2:74335285-74335307 CTCCAGTGGCAGCTCTGCCAAGG - Intronic
932794337 2:74681583-74681605 CTCCAGCAGCTACCAGTCCAGGG - Exonic
933281771 2:80339645-80339667 CTCCAGTAGCACCAAACCCATGG - Intronic
934174737 2:89568904-89568926 CTGCACTAGGAGCCAGCCCAGGG + Intergenic
934285054 2:91643256-91643278 CTGCACTAGGAGCCAGCCCAGGG + Intergenic
934614817 2:95764382-95764404 CTCCAGTAGGAGCCAGGTTCCGG - Intergenic
934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
934761701 2:96860216-96860238 CACCAGGAGGACCCAGGCCAAGG + Exonic
934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
934949296 2:98565540-98565562 CTCCTGTCACAGCCAGGCCTGGG + Intronic
938606134 2:132894734-132894756 CACCACTAGCTGCAAGGCCAGGG - Intronic
938696214 2:133837645-133837667 CTCCAGTGGGAGCCAGCCCGAGG + Intergenic
940058860 2:149542845-149542867 CTCCAGGAGGAACCAGACCAGGG - Intergenic
944549530 2:200832541-200832563 CTCCAGTATCAGCCAAGAAAGGG + Intergenic
947745978 2:232507585-232507607 CTCCAGAAGCAGGCTGCCCAGGG + Intergenic
948312871 2:237002256-237002278 CTCCAGCAGCAGCCTGTGCAGGG - Intergenic
948425137 2:237882690-237882712 CTCCAGTAGCAGCGAGGGCCTGG + Intronic
948738280 2:240025281-240025303 CTTCAGGAGCCGCAAGGCCATGG + Exonic
948767862 2:240232852-240232874 CTCCGGGAGAAGCCAGGCCTCGG - Intergenic
948794598 2:240395756-240395778 CTGCGGGAGGAGCCAGGCCAGGG + Intergenic
948811566 2:240481017-240481039 ATCCCGTAGCAGCGAGGGCAGGG + Exonic
948857301 2:240736025-240736047 CTGCAGGGGCAGCCAGGGCAGGG - Intronic
948908906 2:240993225-240993247 CCCCATGAGCAGCCAGGGCAAGG - Intronic
948994980 2:241573449-241573471 TTCCAGCTTCAGCCAGGCCAGGG - Exonic
1171369212 20:24650038-24650060 CTCCTGTGTCAGCCAGGCCCTGG + Intronic
1171520316 20:25770625-25770647 CTCAAGTAGCATCAGGGCCAAGG + Intronic
1171556603 20:26085868-26085890 CTCAAGTAGCATCAGGGCCAAGG - Intergenic
1171767959 20:29300595-29300617 CTGCAGTCGCGGCCAGCCCACGG + Intergenic
1172175507 20:32969811-32969833 CACCAGTTGCAGACAGTCCATGG + Intergenic
1172291715 20:33781575-33781597 CTCCAGCAGCAGCCCCGACATGG - Intronic
1173918196 20:46725326-46725348 GCCCAGGACCAGCCAGGCCAGGG - Exonic
1174226773 20:49006968-49006990 CTCCAATGGCAGGCCGGCCACGG - Intronic
1175207610 20:57323373-57323395 CTGAAGTAGCAGCCAAGCCCGGG - Intergenic
1175248546 20:57595695-57595717 CCCGAGTGGCAGCCAGGCCTGGG - Intergenic
1175910762 20:62404550-62404572 CTCGATCAGCAGCCAGGCCCAGG + Intronic
1175929160 20:62485479-62485501 CTCCAGAGGAAGCCAAGCCAGGG - Intergenic
1175939308 20:62530639-62530661 CCCCAGACCCAGCCAGGCCACGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1175984994 20:62760287-62760309 GTCCAGGAGGAGCCTGGCCATGG + Exonic
1176078604 20:63260530-63260552 CTCCAAAAGCAGAGAGGCCAAGG - Intronic
1176364324 21:6023484-6023506 CTCCAGTGGAAGCCAGGTCCAGG + Intergenic
1176654451 21:9576912-9576934 CTCAAGTAGCATCAGGGCCAAGG + Intergenic
1179561224 21:42217392-42217414 CTCCAGGAACAGACAGGCCCTGG - Intronic
1179759194 21:43515061-43515083 CTCCAGTGGAAGCCAGGTCCAGG - Intergenic
1180085296 21:45505467-45505489 CTGCAGAACCAGCCAGGGCACGG - Intronic
1181266663 22:21634634-21634656 GTTCAGGAGCAGCCAAGCCAGGG - Intronic
1181505482 22:23353443-23353465 CTCCAGGAGCAGCAAAGCCCTGG + Intergenic
1181609416 22:24002443-24002465 CACCAGCAGCAACCATGCCAAGG + Intergenic
1182031911 22:27165835-27165857 ATCCTGTAGCAGCCACACCAGGG + Intergenic
1182176392 22:28294158-28294180 CTGCAGTAGCAGCTATGCAAAGG + Intronic
1183104379 22:35605923-35605945 CTCCAGTAGCTCCCAGAACAAGG - Intergenic
1184745106 22:46451575-46451597 CTCCAGTAGCATGCGGGCCCAGG + Intronic
1184780722 22:46648016-46648038 ATCCAGTAGCTGCCAGGCTCTGG - Intronic
950263571 3:11559343-11559365 CTCCGGTAGCTGGCAGGCCCGGG + Exonic
953782273 3:45881731-45881753 CCCCAGTAGCACTCAAGCCAGGG - Intronic
954366835 3:50150974-50150996 CACCAGGAGGAGGCAGGCCATGG - Intergenic
955305094 3:57822616-57822638 ATCCTGTAGCAGCCAGGTGATGG + Intronic
956479574 3:69660612-69660634 CTCCAGCCTCAGCCAGCCCAGGG - Intergenic
956783111 3:72620051-72620073 CTCTAGAAGCTGACAGGCCAGGG - Intergenic
958644102 3:96846883-96846905 CTCCAGCAGCAGTCTGGACATGG - Intronic
961351646 3:126308062-126308084 CCCCCGTCCCAGCCAGGCCACGG - Intergenic
961450957 3:127002104-127002126 GCCCAGGAGCAACCAGGCCACGG - Intronic
962326113 3:134433625-134433647 AACCAGAAGCAGCCAGGCAAGGG - Intergenic
964157404 3:153602743-153602765 GTGCAGGAGCAGCCAGGTCATGG - Intergenic
965403290 3:168239507-168239529 CTCCAGTAGCTTCCAGGAAAGGG + Intergenic
966234617 3:177686796-177686818 GTCCAGGAGCAGCCAGGGGAAGG - Intergenic
966877594 3:184332082-184332104 TCCCAGTAAGAGCCAGGCCATGG + Exonic
966919802 3:184604141-184604163 CTGCAGCAGCAGCGAGGCCTCGG - Intronic
967068693 3:185943144-185943166 GGCCAGTGGCAGCCAGGCCAGGG + Intergenic
968876017 4:3268378-3268400 CCACAGAAGCAGCCAGGCCCAGG - Intronic
968878074 4:3284739-3284761 CAGAGGTAGCAGCCAGGCCACGG + Intergenic
968890221 4:3364849-3364871 CTCCTGCAGCAGCCAGGCCCTGG - Intronic
969353423 4:6611315-6611337 CCTCAGCACCAGCCAGGCCAGGG + Intronic
969428326 4:7138698-7138720 CCACTGTGGCAGCCAGGCCAAGG - Intergenic
969480403 4:7443902-7443924 CAGCAGCGGCAGCCAGGCCAGGG - Intronic
969498202 4:7538290-7538312 GGCCAGGAGCAGCAAGGCCAGGG - Intronic
969531620 4:7733846-7733868 CCCCAGTGGGAGCCAGGTCAAGG + Intronic
969621500 4:8281090-8281112 CTCCAGGGGCAGCCAGGGGAAGG - Intronic
969828586 4:9777794-9777816 CTGCACTAGGAGCCAGCCCAGGG + Intronic
971384215 4:26128078-26128100 TAACAGCAGCAGCCAGGCCAAGG + Intergenic
975584342 4:75935787-75935809 TTCCAGAAGCAGCCTGGGCATGG + Intronic
976612159 4:87041322-87041344 CAGCAGCAGCAGCCTGGCCAAGG - Intronic
977928707 4:102729341-102729363 CGCCAACTGCAGCCAGGCCAAGG - Intronic
978102636 4:104861522-104861544 CTCCAGCAGCAGCTAGACTATGG + Intergenic
979985466 4:127308439-127308461 GTCCAGAAACAGCCAGGCAACGG - Intergenic
981915136 4:150024945-150024967 TTCCTGCAGCAGGCAGGCCAGGG + Intergenic
982765768 4:159346834-159346856 CTCCAGTAGCTCCAAGGGCAGGG + Exonic
984650044 4:182261412-182261434 CCCCTGTGGCAGCCAGGTCAGGG + Intronic
984881495 4:184413506-184413528 CTCCAGTAGCAGCCCTGCCAGGG + Intronic
984918945 4:184747396-184747418 CTGTAGGAGCAGCCAGGCCAGGG + Intergenic
985183805 4:187295074-187295096 CTCCAGTTGAATCCAGGCCAAGG - Intergenic
985509551 5:305087-305109 CTCCAGGGGCAGGCAGGCCTGGG + Intronic
985685566 5:1279904-1279926 CACAAGAAGCAGCCGGGCCAGGG - Intronic
985738724 5:1601804-1601826 CTCCAGGGGCAGGCAGGCCTGGG - Intergenic
987089627 5:14499175-14499197 ATCCAGGAGGAGCCAGGCCCAGG + Intronic
991252023 5:64573457-64573479 GTACAGTAGCATCCAAGCCATGG - Intronic
996343817 5:122468396-122468418 CTCCAGTAGCAGCTAGGAAATGG - Intergenic
996930192 5:128877006-128877028 CTACATTAGGAGCCAGGACAGGG - Intronic
999365427 5:151020653-151020675 CGCCTGCAGCAGCCGGGCCATGG - Exonic
999897763 5:156053226-156053248 CTTCAGCAGCAGCCTGGGCAAGG - Intronic
1000120622 5:158194543-158194565 CTTCAGTAGAAGCCAAGCCCAGG - Intergenic
1001383307 5:171317983-171318005 CCCCGGTAGCAGCCAGCGCATGG - Intergenic
1001914105 5:175545179-175545201 TTCTAGTCTCAGCCAGGCCAGGG - Intergenic
1002454183 5:179336918-179336940 CTTCAGCAGCACCCAGGCCTTGG + Intronic
1003963286 6:11229335-11229357 AGCCATTAGCAGCCAGGCCAAGG + Intronic
1004733299 6:18380188-18380210 CTCCTGTAGGATCCAGGACAGGG + Intergenic
1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG + Exonic
1007234192 6:40378644-40378666 CTGCAGCTGCAGCCAAGCCAGGG - Intergenic
1007815930 6:44525557-44525579 TTCCAGTGGAAGCCAGGCCAGGG - Intergenic
1008165974 6:48138847-48138869 CTCAAGTAGAAGGCAGACCATGG + Intergenic
1008491094 6:52088132-52088154 CTCCAGTCGTACCCAGACCATGG + Intergenic
1010335911 6:74683488-74683510 CTCCACTAACAGCCAGCACAAGG + Intergenic
1013475606 6:110504597-110504619 CCCCAGTTGCAGCCATGTCAAGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1015714749 6:136180923-136180945 CTACAGAAGGAGCCAGGCCATGG + Intronic
1016451502 6:144187483-144187505 CTCAAGTAGCAGGCCGGCCCGGG + Exonic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG + Intergenic
1018813953 6:167317231-167317253 CTCCCTGATCAGCCAGGCCAGGG - Intergenic
1019183455 6:170207464-170207486 ATCCAGGAGCTGCTAGGCCAGGG - Intergenic
1019429771 7:993289-993311 CTCCAGTCACAGTCAGGCCCTGG - Intergenic
1019605142 7:1906393-1906415 CTGCAGTGGCAGCCAGGCCGGGG - Intronic
1019910801 7:4099662-4099684 CTCCAGGGCCAGCCAGGCCCAGG + Intronic
1020026713 7:4904819-4904841 CTCCAGGAGCTCCCAGGCCTGGG + Intergenic
1020804464 7:12771579-12771601 TTCCAGTTGCAGCGAGGCCAGGG + Intergenic
1022508597 7:30921750-30921772 ATCCAGCTGCATCCAGGCCAGGG - Intronic
1023067858 7:36396795-36396817 CTCCGGTACCAGCAAGGCAATGG + Intronic
1023531538 7:41161660-41161682 CCCAAGCAGCAGTCAGGCCATGG + Intergenic
1023617797 7:42038200-42038222 GTGCAGGAGCAGCCAGGCCAGGG + Intronic
1028844319 7:95462096-95462118 CTTCTCTAGCACCCAGGCCAAGG + Intergenic
1030325274 7:108212085-108212107 CTCCAATAGCAGCCTGGAGATGG + Intronic
1031956972 7:127952549-127952571 CTCCAGGGGCTGCTAGGCCATGG - Intronic
1033541431 7:142359341-142359363 ATCCATTGGCATCCAGGCCAAGG - Intergenic
1033613333 7:142986962-142986984 CCACAGTAGAAGCCAGGACAGGG - Intergenic
1035464421 7:159065291-159065313 CTCCTGTAGCAGCCACTGCAGGG - Intronic
1035616127 8:1003135-1003157 CTGAAGGAGCAGCCAGGGCATGG - Intergenic
1035977043 8:4324343-4324365 CTGTAGTAGCAGCCATTCCATGG + Intronic
1036793276 8:11737572-11737594 CAGCATTAGAAGCCAGGCCAGGG + Intronic
1037170964 8:15891312-15891334 TTCCAGTAGCAGAAAAGCCAAGG - Intergenic
1038554257 8:28495008-28495030 ATCCAGCAGCAGCCACCCCACGG - Intronic
1039544856 8:38402394-38402416 TTGCAGTAGCAGCCAGTGCAGGG + Intronic
1041293642 8:56332813-56332835 CTCCAGTACCAGCCTGGAGAAGG - Intergenic
1043287656 8:78554235-78554257 CACCAGTTGACGCCAGGCCAGGG + Intronic
1043296196 8:78666230-78666252 CACCAGTAGCAGGAAGGCGAGGG + Intronic
1046398801 8:113676542-113676564 CTGCAGCAGCAGCCAGGCAGGGG - Intergenic
1048372626 8:133792783-133792805 CTCCAACAGCAGCGAGGACAAGG + Intergenic
1049000625 8:139823591-139823613 CTCCAGGAGCTGCCATGCCCAGG + Intronic
1052996219 9:34552849-34552871 CTCCACCTGCAGCCAGACCATGG + Exonic
1054863645 9:69978045-69978067 CTCCAGCAGCAGGCGGACCAGGG - Intergenic
1056589185 9:87951865-87951887 TTGCAGGAGCAGCCAGGCAAAGG + Intergenic
1057013659 9:91631423-91631445 CTCCAGTAGGAGCCAAGTCATGG - Intronic
1057200517 9:93137402-93137424 CTTCAGAAGCAGCCAGTCCCTGG + Intergenic
1057502422 9:95606046-95606068 CTCCAGTACCCCCCAGGCCCAGG - Intergenic
1059380461 9:113919598-113919620 CACCAGCAGCAGCCGGCCCAGGG - Intronic
1060017513 9:120099361-120099383 ATCCTCCAGCAGCCAGGCCATGG - Intergenic
1060605265 9:124908400-124908422 AGCCAGAAGCAGCCAGGCTAAGG - Exonic
1203632171 Un_KI270750v1:80370-80392 CTCAAGTAGCATCAGGGCCAAGG + Intergenic
1186485097 X:9928148-9928170 CTTCAGTGGCGGCCAGCCCAGGG + Intronic
1187263552 X:17709732-17709754 CACCAGCACCAGCCAGGCCACGG - Intronic
1192180644 X:68913681-68913703 CTCCAGTGGCAGAGAGGCCGAGG + Intergenic
1192201113 X:69067339-69067361 CTGCAGTGGCAGCGGGGCCAGGG - Intergenic
1192351576 X:70360703-70360725 CTCCCGGAGCAGCCTGCCCAGGG + Intronic
1200083260 X:153589885-153589907 CTCCAGGAGCACACAGGTCATGG - Intronic
1200108973 X:153729426-153729448 CTCCAAGAGGATCCAGGCCAGGG + Intronic