ID: 1085738149

View in Genome Browser
Species Human (GRCh38)
Location 11:79057247-79057269
Sequence GTGTGTGCAGGCCAGTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085738149_1085738154 -1 Left 1085738149 11:79057247-79057269 CCCCTGCACTGGCCTGCACACAC 0: 1
1: 0
2: 4
3: 40
4: 369
Right 1085738154 11:79057269-79057291 CCCCTACTCCCTCCCCTCTTTGG 0: 1
1: 0
2: 3
3: 45
4: 470
1085738149_1085738164 25 Left 1085738149 11:79057247-79057269 CCCCTGCACTGGCCTGCACACAC 0: 1
1: 0
2: 4
3: 40
4: 369
Right 1085738164 11:79057295-79057317 CCTCTACCATCTAGCCACTCTGG 0: 1
1: 0
2: 1
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085738149 Original CRISPR GTGTGTGCAGGCCAGTGCAG GGG (reversed) Intronic
900140164 1:1136482-1136504 GTGGGTGCTGGGCAGGGCAGAGG + Intergenic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900971696 1:5995502-5995524 GTGTGTCCAGGTCACTGGAGGGG + Intronic
901181683 1:7346519-7346541 GAGCTTGCAGGCCAGTGTAGAGG - Intronic
901627336 1:10631594-10631616 GTGGGTGCAGCCCAGTACTGGGG - Intergenic
901664227 1:10817322-10817344 GTGAGTGCAGGCCAGTGCATTGG - Intergenic
901686304 1:10945504-10945526 GTGTGAGCGGGAGAGTGCAGCGG - Intergenic
901780336 1:11590111-11590133 GTGTGTGGAGGTGAGTGCTGAGG - Intergenic
902737819 1:18412885-18412907 GTGGGAGCAGGCCTGTGCAATGG + Intergenic
903279392 1:22241997-22242019 GTGTGTGTGGGCCAGGGCTGAGG + Intergenic
904450106 1:30605607-30605629 GTGTGTGAGGGCGAGTGCACAGG - Intergenic
904756862 1:32772723-32772745 GGGTGTCCAGCCCAGTGCTGCGG + Intronic
905150182 1:35921085-35921107 AAGAGTGCAGGACAGTGCAGAGG - Exonic
905770622 1:40635893-40635915 GTGCGTGCAGCCCCGTGCTGTGG - Intronic
906688367 1:47777148-47777170 GTCTGTTCTGGCCAGGGCAGGGG - Intronic
907387867 1:54137699-54137721 GTGTGTGCATGCGGGGGCAGGGG + Intronic
907407962 1:54265348-54265370 GTGTTTACAGGCCAGAGCTGGGG + Intronic
907540713 1:55214278-55214300 GTGTGGGCCGGCCAGAGTAGTGG - Intronic
907548344 1:55282935-55282957 GTGTGTGTTGGCCAGAGTAGTGG + Intergenic
907717790 1:56943716-56943738 GTGTCTGTAGGCAAATGCAGAGG - Exonic
910227962 1:84955646-84955668 GTTTCTGCAGGGCAGGGCAGGGG + Intronic
911564090 1:99441929-99441951 AAGTGGGCAGGCCAGTTCAGAGG + Intergenic
912552059 1:110490772-110490794 GGGAGTGGAGTCCAGTGCAGAGG + Intergenic
915067703 1:153240293-153240315 GCATGTGCAGGCCATTGCAAGGG - Intergenic
917685770 1:177414304-177414326 GTGTATTCAGGCCAGTCCACAGG + Intergenic
918053110 1:180991698-180991720 GTGTGTGGGTGCCAGAGCAGGGG + Intronic
920037300 1:203074754-203074776 GGGTGGGGAGGCCTGTGCAGAGG + Intronic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
920446889 1:206024435-206024457 GTGTGTGGAGGAGAATGCAGGGG + Intergenic
922606750 1:226894326-226894348 GCCTGTGGAGGACAGTGCAGGGG + Intronic
923111575 1:230894834-230894856 GGGTGTGCAGGTCAGTGCAAGGG - Intergenic
923463380 1:234226934-234226956 GTGCGCGCACGCCAGTGCAGGGG - Intronic
1062959646 10:1562809-1562831 GTGTGGGGAGGCCACTGCATGGG + Intronic
1064342286 10:14498332-14498354 GTGTGTTCATGCAAGTGCACGGG + Intergenic
1065623301 10:27605850-27605872 GAGTGTGCAGGGCAGGGAAGGGG + Intergenic
1067452191 10:46388648-46388670 GTGTGTGCAGGGAACAGCAGAGG + Intronic
1067540904 10:47152037-47152059 GGATGTTCAGGCCAGGGCAGAGG - Intergenic
1067585046 10:47471107-47471129 GTGTGTGCAGGGAACAGCAGAGG - Intronic
1068026299 10:51649717-51649739 GTGGGTGCAGACCCGAGCAGTGG + Intronic
1068871617 10:61951127-61951149 GTTTATGCAGGTCACTGCAGAGG + Intronic
1068911626 10:62384178-62384200 GTGGGTGCAGACCAGTGTTGGGG - Intronic
1069885024 10:71618318-71618340 GTGTGTCAGGACCAGTGCAGGGG - Intronic
1070053726 10:72914168-72914190 GGATATGCAGGCCTGTGCAGAGG + Intronic
1070802688 10:79252723-79252745 GTGTGTGCAGGCATCTGCTGGGG + Intronic
1072758694 10:98038404-98038426 GTGTGTGCAGGTGAGGGCACAGG + Intergenic
1072847282 10:98845757-98845779 GTGTGTCCTGACCAGTGCACAGG + Intronic
1073054123 10:100688316-100688338 GGGAGAGAAGGCCAGTGCAGAGG + Intergenic
1073307802 10:102516804-102516826 GTGAGTTTAGGCCAGTACAGAGG - Intronic
1073326488 10:102646375-102646397 GTTAGTGGAGGCCAGTGCGGAGG + Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1076794862 10:132793546-132793568 CTGTGTGCTGGCCACTGCAGGGG - Intergenic
1077219421 11:1408980-1409002 GTGTGTGTATGTCTGTGCAGGGG + Intronic
1077441597 11:2571568-2571590 GTGGGTGCAGGCAAGTGTGGAGG + Intronic
1077529236 11:3087517-3087539 GTGGGTGCAGGTGTGTGCAGGGG - Exonic
1079133586 11:17763480-17763502 GTGTGTGGGGGGCAGTGCATGGG - Intronic
1079976989 11:27104237-27104259 GTGTTTACTGGACAGTGCAGTGG - Intronic
1080042616 11:27774818-27774840 GTGTGTGCAGGAGAGGGCAATGG + Intergenic
1080283269 11:30583765-30583787 GGCTGTGCTGGGCAGTGCAGGGG - Intronic
1080531653 11:33182137-33182159 CTTTGTTCAGGCCGGTGCAGTGG - Intergenic
1081222793 11:40482756-40482778 GTGTGACCAGGCAGGTGCAGTGG - Intronic
1081235243 11:40639298-40639320 GCTGGTGCAGGCCAGTGCAAGGG - Intronic
1081644459 11:44779974-44779996 GTGTGTGCAGGTATGTGCAAAGG - Intronic
1084170666 11:67399424-67399446 GTGAGTGCAGCCCAGCACAGTGG + Intronic
1084180236 11:67442457-67442479 GATTGTGGAGGCCAGTGGAGGGG - Exonic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084446053 11:69204353-69204375 GTCTGTGCAGGCAGGAGCAGAGG + Intergenic
1084709882 11:70837323-70837345 GTGTGTCCAGGCCAGTGGGAGGG - Intronic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1085743859 11:79098431-79098453 CTGAGTGGAGGCCAGTGCACAGG - Intronic
1086084138 11:82937818-82937840 CTGTGTGTAGGCCTGTGCATTGG - Intronic
1086917534 11:92547884-92547906 ATGTGTGGAGGGCTGTGCAGAGG + Intronic
1088132015 11:106504023-106504045 CTGTGTTCAGGCCAGAGCACAGG - Intergenic
1089307096 11:117533548-117533570 TTGTGTGCAAGGCAGTGAAGAGG + Intronic
1090270711 11:125384082-125384104 ATGTGTGCATGCGAGTGCATGGG - Intronic
1090836624 11:130458765-130458787 GAGTGTGCAGGGCAGCCCAGAGG + Intronic
1091194764 11:133721182-133721204 GTGGCTGCAGGCCAGGGAAGTGG - Intergenic
1092075694 12:5671533-5671555 GTGTGTGCATCTCAGGGCAGAGG + Intronic
1092239359 12:6827885-6827907 GTGTGTGTGGGGGAGTGCAGGGG + Intronic
1092262660 12:6960787-6960809 GTGTCTGCAGCCGGGTGCAGGGG - Exonic
1097397080 12:59088524-59088546 GTGTGTGGAGGTCAGAGCATGGG + Intergenic
1100649731 12:96572206-96572228 GTGTGGACAGGCAAGTACAGAGG + Intronic
1100734147 12:97508336-97508358 GAGAGTGCAAGCCAGTGCTGTGG + Intergenic
1102074003 12:110045544-110045566 CTGTTGCCAGGCCAGTGCAGTGG - Intronic
1102521038 12:113477512-113477534 GTGAGTGCCGGCCAGCTCAGAGG + Intergenic
1102663245 12:114547775-114547797 TGCTGTGCAGGTCAGTGCAGGGG - Intergenic
1104049042 12:125184365-125184387 CTGTGTGCCGGCCTCTGCAGGGG - Intergenic
1104728462 12:131092382-131092404 GGGTGTGCAGGCCAGGGAGGTGG + Intronic
1106076888 13:26468129-26468151 CTCTGTGCAGGGCTGTGCAGGGG - Intergenic
1107944704 13:45407402-45407424 GTGTGTGCAGCTAGGTGCAGTGG + Intronic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1108342912 13:49515272-49515294 GTGGGGACAGGCCAGTGCTGTGG + Intronic
1108509871 13:51147065-51147087 GTGGGGGCAGGCCAGGGGAGAGG + Intergenic
1109270790 13:60252940-60252962 GTGTCTGGGGCCCAGTGCAGTGG + Intergenic
1109521194 13:63512271-63512293 GTGTGAGCAAGTGAGTGCAGGGG - Intergenic
1118303953 14:64639052-64639074 CTGTGTGCTGGGGAGTGCAGGGG + Intergenic
1118710197 14:68512573-68512595 GAGTGTGGGGGCCAGGGCAGAGG - Intronic
1118922306 14:70160604-70160626 ATGTGAGCAGACCAGGGCAGGGG + Intronic
1119779052 14:77266147-77266169 GTGAGTGCAGGCCAAGGCGGGGG - Exonic
1121101374 14:91252799-91252821 GTGTGTGCAGGTAGGGGCAGAGG + Intronic
1121274124 14:92656362-92656384 GTGTGTGGAGGGCAGAGGAGAGG + Intronic
1122625960 14:103085438-103085460 GTGGGTGCGGCCAAGTGCAGGGG + Intergenic
1122810091 14:104283468-104283490 GGGTGGTCAGGCCAGTGCTGAGG + Intergenic
1124154497 15:27213788-27213810 GAGTTTGAAGGCCAGTACAGTGG - Intronic
1124685354 15:31777594-31777616 GTGTGTGGAGTGCAGTGTAGAGG + Intronic
1125355957 15:38817744-38817766 GTGTGTCAAGGCCAGTTTAGTGG + Intergenic
1128222650 15:65980046-65980068 GTGTGTGTGTGCAAGTGCAGGGG + Intronic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1129883699 15:79023885-79023907 GTGTGTGAAGGGCAGGGTAGAGG - Intronic
1130681765 15:86003092-86003114 GTGTGTGGAGGACATGGCAGAGG + Intergenic
1131158730 15:90090758-90090780 ATGAGTGAAGGCCAGTGGAGGGG + Intronic
1131424352 15:92333599-92333621 GTGGGTCGAGGCCAGTTCAGGGG + Intergenic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132525395 16:411695-411717 GTGTGGGCAGGCTGGCGCAGGGG - Intronic
1132565106 16:618597-618619 GTGTGTGCAGCCATGTGCACAGG + Intronic
1132565127 16:618720-618742 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565143 16:618841-618863 GTATGTGCAGGCATGTGCACAGG + Intronic
1132565162 16:618961-618983 GTGTGTGCAGGCATTTGCACAGG + Intronic
1132565178 16:619082-619104 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565198 16:619207-619229 GTGTGTGCAGGCATGTGCACAGG + Intronic
1132565217 16:619332-619354 GTGTGTGCAGCCATGTGCACAGG + Intronic
1133975447 16:10597057-10597079 GTGTGTGCAAGTCATTGTAGGGG - Intergenic
1134373060 16:13643726-13643748 GTGTGTGCATGCCTGTGGGGAGG + Intergenic
1134422572 16:14108027-14108049 GTGGGTCCAGGCCACAGCAGTGG + Intronic
1134522804 16:14926284-14926306 GTGAGTGCAGGCCTGCGTAGGGG + Intronic
1134710473 16:16324935-16324957 GTGAGTGCAGGCCTGCGTAGGGG + Intergenic
1134718646 16:16369223-16369245 GTGAGTGCAGGCCTGCGTAGGGG + Intergenic
1134949130 16:18343710-18343732 GTGAGTGCAGGCCTGCGTAGGGG - Intergenic
1134956108 16:18382936-18382958 GTGAGTGCAGGCCTGCGTAGGGG - Intergenic
1135100080 16:19597488-19597510 GGGTGTGCAGGGCAGTGAGGTGG + Intronic
1135326738 16:21530912-21530934 GTGAGGGCAGCCAAGTGCAGGGG - Intergenic
1135683960 16:24482683-24482705 GTGTGTCTAGGCCTATGCAGTGG + Intergenic
1135800402 16:25488990-25489012 GTGAGTGCACACCAGTGAAGTGG + Intergenic
1138550193 16:57743662-57743684 GTGTGTGTGAGCCAGGGCAGGGG - Intronic
1141712299 16:85707081-85707103 GTGTGTGCAGGCCATTGTGGGGG - Intronic
1141760644 16:86026503-86026525 GTGTGTGCAGGCCTGCCTAGGGG + Intergenic
1142039789 16:87885662-87885684 GTGAGGGCAGCCAAGTGCAGGGG - Exonic
1142142778 16:88479887-88479909 GTGGGTGAAGGCCAGGGCTGGGG - Intronic
1142255109 16:89010087-89010109 GTGTGTGCAGGCTTGTGCATGGG - Intergenic
1144838981 17:18174012-18174034 GAGTATCCAGGCCAGTGCATGGG + Intronic
1145964306 17:28906148-28906170 GGGTGTACAGGCCAGTGGCGGGG + Exonic
1147260003 17:39204326-39204348 GTGTGTACAGGACAGAGGAGTGG - Intronic
1147428415 17:40357097-40357119 GTGGGTGCAGGCAAGTGCCAAGG - Intronic
1147783702 17:42962742-42962764 CTGAGTGGAGGCCAGGGCAGTGG + Intronic
1148697979 17:49572527-49572549 GTGTGTGCAGGGCATGGCTGGGG + Intergenic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1148975931 17:51528192-51528214 GTGTTTGCAGGATAGAGCAGAGG - Intergenic
1150158685 17:62875466-62875488 GTATGTGGAGGTCAGAGCAGTGG + Intergenic
1150281162 17:63930454-63930476 GTCTGTGCCAGCCAGGGCAGGGG - Intronic
1150504941 17:65689053-65689075 GTGTGTGCAGCCAGGTGCAGTGG - Intronic
1151404192 17:73876224-73876246 GTCTGTGCAGGGCACTGCACGGG - Intergenic
1151558547 17:74859365-74859387 GTGTGTGCAGGTCCGTGCCAGGG - Intronic
1151588450 17:75026469-75026491 TTTTGTTTAGGCCAGTGCAGGGG - Intergenic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1152075176 17:78154929-78154951 GTCTGTGCAGCCCTGGGCAGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152230695 17:79112728-79112750 GTGTGGCCAGGGCAGTGGAGAGG - Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153598233 18:6751024-6751046 GAGGCTGCAGTCCAGTGCAGGGG - Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1155175439 18:23297766-23297788 GGGTCTGCAGGTCACTGCAGAGG - Exonic
1157530664 18:48418079-48418101 ATGTGAGAAGGCCACTGCAGTGG + Intergenic
1158017149 18:52797677-52797699 GTGTGTGCAGGCACCAGCAGTGG + Intronic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1158575569 18:58634629-58634651 GTGTGTGCAGGGCAGACCATGGG + Intergenic
1158835697 18:61329592-61329614 GTGTGTGCATGGCAGGGCTGAGG + Intergenic
1159102951 18:63975371-63975393 GTATGTGCAGGCAAGTCCCGGGG - Intronic
1160261584 18:77299269-77299291 GTGTGAGCAGGGCAGAGCAGGGG - Intergenic
1160663759 19:313355-313377 GTGTGTGGGGGCCAGGGCACTGG - Intronic
1160793783 19:934601-934623 GGGTGTACCGGGCAGTGCAGAGG + Intronic
1160861703 19:1239979-1240001 CCGTGTTCAGGCCAGTGCAATGG - Intergenic
1161170146 19:2808445-2808467 GTGGGTGCGGGCCCGGGCAGGGG + Intronic
1161459079 19:4385832-4385854 GTATGTGCTGCCCACTGCAGAGG - Intronic
1161566373 19:5005047-5005069 GTGTGTGCCGGCCTGTCCTGCGG + Intronic
1161839354 19:6669723-6669745 GTGTGTGTAGGACAGGGCACAGG - Intronic
1162380233 19:10327571-10327593 GTGAGCGGAGGCCAGTGCAGAGG - Intronic
1162726277 19:12691319-12691341 GTGTGTGGGGGCCTGGGCAGGGG - Intronic
1163091055 19:15020825-15020847 GTGTGGGCAGGAGAGTGCAGGGG - Intronic
1163546025 19:17942003-17942025 GTCCGTGCAGGCCAGGGCAAGGG + Intronic
1163674986 19:18651236-18651258 GTGTTGGCAGGCTAGTGGAGTGG - Intronic
1163785294 19:19272037-19272059 GTGGGTGCAGATCAGGGCAGGGG - Intronic
1164611657 19:29636588-29636610 GTGGGTGCAGCCCAGAGAAGTGG + Intergenic
1164690345 19:30206296-30206318 GTGTTTGCAGGCTGGTGAAGGGG + Intergenic
1165171437 19:33894737-33894759 GCGTGTGCACGGCATTGCAGTGG - Intergenic
1165171455 19:33894841-33894863 GCGTGTGCACGGCATTGCAGTGG - Intergenic
1165171468 19:33894895-33894917 GCGTGTGCATGGCATTGCAGTGG - Intergenic
1165171499 19:33895052-33895074 GTGTGTGCATCGCATTGCAGTGG - Intergenic
1165171522 19:33895158-33895180 GTGTGTGCACGGCATTGCAGTGG - Intergenic
1167112215 19:47469148-47469170 GTGTGTGCAGGCAAGGGTGGGGG + Intronic
1167649291 19:50720606-50720628 GTGAGTGCGAGCCAGTGCAATGG - Intergenic
925933676 2:8732763-8732785 GAGTGGGCAGGGCAGGGCAGCGG - Intronic
926067728 2:9857748-9857770 GTGTGAGCAAGCCCATGCAGGGG + Intronic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927155201 2:20217322-20217344 GTGTGCGTAGCCCTGTGCAGTGG - Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
928121184 2:28584659-28584681 GGGAGTGCAGGGCACTGCAGAGG - Intronic
929130534 2:38565231-38565253 GTGTGTACAAGACACTGCAGAGG + Intronic
930935569 2:56946733-56946755 GTGTGTGGGGGACAGGGCAGTGG + Intergenic
931796081 2:65711522-65711544 GTGTGTGCAGGCCTGCACATGGG + Intergenic
932704987 2:74017247-74017269 GTGTGTGGAGTGGAGTGCAGCGG - Intronic
934563018 2:95323023-95323045 GTGGGTGGAGGCCAGAGCGGGGG - Intronic
935310189 2:101775818-101775840 ATGTGGTCAGGCCAGTGAAGGGG + Intronic
935550761 2:104450973-104450995 GTGTGTGTAGGGAAGTGGAGAGG - Intergenic
935554310 2:104490932-104490954 GGGTGTGCAGGGAAGTGGAGAGG + Intergenic
935756923 2:106283604-106283626 TTGGGTGCATGCCAGGGCAGAGG + Intergenic
937804392 2:126121423-126121445 GTGTGTGCAAGCAAGTGTAGGGG - Intergenic
938069139 2:128299339-128299361 GAGTGGGCCGGCCAGGGCAGAGG - Intronic
938789736 2:134666113-134666135 GTATGTGCAGTGCAGTGTAGAGG - Intronic
938973702 2:136456012-136456034 ATCTGTGCAGGCCAGAGCAGTGG - Intergenic
940432586 2:153610633-153610655 TTCTGTGCACCCCAGTGCAGTGG - Intergenic
943304957 2:186249448-186249470 ATGTGTGCAGCCAGGTGCAGTGG + Intergenic
945256205 2:207805374-207805396 CTGTTCTCAGGCCAGTGCAGTGG - Intergenic
947997399 2:234539898-234539920 GTGAGTGCAGGTGAGCGCAGTGG + Intergenic
948384148 2:237571274-237571296 GTGTGTGCCAGACAGTGTAGAGG + Intergenic
948510073 2:238458209-238458231 CTGTGTGCAGCTCAGTGCTGTGG + Intergenic
948563489 2:238868833-238868855 CTGCGTGCCGGCCGGTGCAGGGG + Intronic
948659442 2:239498097-239498119 TTGTGTGGAGGCCGGTCCAGGGG - Intergenic
948802727 2:240440164-240440186 GTGTGTGTGGGCCTTTGCAGAGG - Intronic
948903447 2:240967214-240967236 AGGTGTGCAGGGCAGGGCAGTGG - Intronic
1168896034 20:1324298-1324320 ATGTGTGCTGGGCAGTGCCGTGG - Intronic
1169143023 20:3236758-3236780 CTGTGTGAAGGGCAGTGGAGGGG - Intronic
1170032247 20:11955763-11955785 GTGTGTGCAGCCCAGGGCCCAGG + Intergenic
1170191829 20:13652269-13652291 GAGTCAGCAGGCCAGCGCAGTGG + Intergenic
1170532925 20:17312610-17312632 CTGTGTGCAGAACAGTGCATAGG - Intronic
1171197072 20:23208036-23208058 GCGTGTGCAGTGCAGGGCAGTGG - Intergenic
1171242816 20:23585684-23585706 CTGGGTACAGGCCACTGCAGTGG - Intergenic
1171343908 20:24451530-24451552 GTGTGTGCAGGCAGCAGCAGTGG - Intergenic
1171371630 20:24666029-24666051 GGGTCTGCAGAGCAGTGCAGCGG - Exonic
1171411601 20:24951708-24951730 GTCTGTGCAGTTCAGTGCATGGG - Intronic
1172234712 20:33363608-33363630 GAGAGTTCAGGCCACTGCAGTGG + Intronic
1173418991 20:42883919-42883941 GTGTGTGCATGCCTGTGTACTGG - Intronic
1173657018 20:44706458-44706480 GTGTGTGCTGCCGTGTGCAGAGG + Intergenic
1174710149 20:52695821-52695843 GGTAGTCCAGGCCAGTGCAGTGG - Intergenic
1175850437 20:62088186-62088208 GTGTGTGCAGGTGAGTGTACAGG - Intergenic
1175863927 20:62164478-62164500 CCGCGTGGAGGCCAGTGCAGCGG - Intronic
1175916962 20:62430495-62430517 GGGTGGGGTGGCCAGTGCAGTGG + Intergenic
1175970552 20:62684713-62684735 GTGTGTCCAGGGCAGTGGGGGGG - Intronic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1176273971 20:64253191-64253213 CTGTGAGGAGGCCAGGGCAGAGG + Intergenic
1176310351 21:5145901-5145923 GTGTGCCCAGGGCAGGGCAGAGG - Intronic
1178516448 21:33251513-33251535 TTGTGTGCTGGCCACTGGAGGGG + Intronic
1178526811 21:33337036-33337058 GTGTATCTAGGCCAGGGCAGTGG - Intronic
1179441005 21:41394122-41394144 ATGTCTGGAGGCCAGTGGAGAGG - Intronic
1179500053 21:41802988-41803010 GTGTGTCCAGGGCAGTGCTGGGG - Intronic
1179846704 21:44116134-44116156 GTGTGCCCAGGGCAGGGCAGAGG + Intronic
1179962783 21:44779579-44779601 GTTTGTTCAGGCCATTGCAGGGG - Intronic
1180130684 21:45825069-45825091 CTGTATGCAGGCCAGGGCTGAGG - Intronic
1180737294 22:18026846-18026868 ATGTGTGGAGGGCAGTGGAGTGG - Intergenic
1181264399 22:21622356-21622378 CTCTGTGCAGGCCAGGCCAGAGG - Exonic
1181323363 22:22025697-22025719 GTGTGCGCAAGGCAGTGCTGAGG + Intergenic
1181495349 22:23284458-23284480 GTGTGTGCACGCCTATGCCGAGG - Intronic
1181543058 22:23584185-23584207 ATGTGTCCAGGCCTGGGCAGAGG + Intergenic
1182456044 22:30451131-30451153 GTGGGGGCAGGCCAGGTCAGGGG + Intronic
1182548175 22:31087392-31087414 CTAGGTCCAGGCCAGTGCAGTGG + Intronic
1183543504 22:38443395-38443417 GTGTCTGCTGGACAGTGAAGAGG + Intronic
1183588758 22:38768041-38768063 GAGTGTGGAGGCAAGAGCAGTGG + Intronic
1183733466 22:39630899-39630921 GTGTGTGCAGGGCTGGGGAGTGG + Intronic
1184120017 22:42444111-42444133 GCGGGTTCAGGCCAGGGCAGCGG - Intergenic
1184952053 22:47850354-47850376 GTGTGTGCATGTCAGTGTGGGGG + Intergenic
1185014027 22:48333179-48333201 GTGGGTTCAGGCCAGCGCTGGGG - Intergenic
1185136055 22:49073316-49073338 GTGTGGGCAGGCCAGGGCTTAGG - Intergenic
1185233032 22:49694159-49694181 GTGGGTGCAGGTGAGTGCAGGGG - Intergenic
949553718 3:5133934-5133956 GGGTGTGCTGTGCAGTGCAGGGG - Intronic
950900069 3:16489618-16489640 ATGAGAGCAGGCCAGTGCAGTGG + Intronic
953465075 3:43112721-43112743 GCGTGTGGAGGCCAGTTCATGGG - Intergenic
953805417 3:46063683-46063705 GTGTGTGCCCCACAGTGCAGTGG - Intergenic
954395012 3:50288886-50288908 GAGTGCGCAGGACACTGCAGAGG + Exonic
954633952 3:52061446-52061468 GAGTGTGCAGGACAGTGAAGGGG + Intergenic
958606552 3:96364960-96364982 GTGTGTGCAGGCACTAGCAGTGG - Intergenic
959785926 3:110297053-110297075 TTGTGTGGTGGCCAGTGCTGAGG - Intergenic
960536986 3:118825638-118825660 GTGGTTACAGTCCAGTGCAGTGG - Intergenic
962755685 3:138464114-138464136 GAGTGTGGAGGCCAGGGCTGTGG + Intronic
964392482 3:156212193-156212215 CTGTGTGCAGACCAGGGAAGAGG + Intronic
964500918 3:157347573-157347595 GGGAGAGCAGGCAAGTGCAGCGG + Intronic
964703971 3:159598616-159598638 GTCTGTGAAGGCAGGTGCAGGGG - Intronic
965449205 3:168816739-168816761 GTGTGTGGAAACCAGTGAAGAGG + Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967269994 3:187725395-187725417 GAGTGGGCAGGCAAGTGGAGCGG - Intronic
967545644 3:190723936-190723958 GTGTGTTCAATCCAGTGAAGTGG + Intergenic
967852992 3:194096038-194096060 GTGAATGCATGCCAGTGCACGGG - Intergenic
967987458 3:195106412-195106434 GTGTGTGCGGGGCCGTGCTGGGG - Intronic
968445929 4:652035-652057 GAGTGTGGAGGCCAGTGAGGAGG + Intronic
968554982 4:1242294-1242316 GTGTCTTCATGCCAGAGCAGGGG - Intronic
968573285 4:1353570-1353592 GTGGGGGGAGCCCAGTGCAGAGG - Intronic
968648302 4:1750532-1750554 GTGGGTCCAGGGCAGTGCTGGGG + Intergenic
969069596 4:4524637-4524659 GTGTGTGCAAGGCAGAACAGAGG + Intronic
969218805 4:5746050-5746072 GTGGGTGCTGGCCAGTGGTGGGG + Intronic
969238858 4:5887017-5887039 GCGGATGCAGGACAGTGCAGGGG + Intronic
969266098 4:6065074-6065096 TCGTGGGCATGCCAGTGCAGGGG + Intronic
976262344 4:83157798-83157820 CTCAGTGCACGCCAGTGCAGTGG + Intergenic
977065179 4:92305011-92305033 GTGTGTGCTGGGAACTGCAGGGG + Intronic
977810192 4:101348008-101348030 GTGTGAGTAGCCAAGTGCAGAGG + Exonic
978420956 4:108532382-108532404 GTGTGTGCTGGGCAGGGCGGAGG - Intergenic
979511991 4:121565257-121565279 TTATGTGCAGGCCAGAGAAGCGG + Intergenic
979831905 4:125315086-125315108 GTGTGTGCATGCCTGTGCGGCGG + Intergenic
985426536 4:189836811-189836833 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985426545 4:189836915-189836937 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985426582 4:189837266-189837288 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985426591 4:189837370-189837392 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985533537 5:448205-448227 GTGTGCACAGGCCAGGGCAGAGG + Intronic
985730604 5:1545634-1545656 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985730616 5:1545740-1545762 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985921772 5:2983210-2983232 GAGTGTGCTGGCCAGGGCAGAGG + Intergenic
986710674 5:10486084-10486106 GTGTGAGCAGCCCAGAGCAGGGG - Intergenic
987380193 5:17277775-17277797 ATGTGTGAAGGCCAGTGTAATGG + Intergenic
987594231 5:19974839-19974861 GTGGGTGCTGGCCTGTGAAGAGG + Intronic
989236032 5:39149673-39149695 GACTGTGGAGGTCAGTGCAGGGG - Intronic
995078799 5:108020979-108021001 GTGTGTGGAGGTCATTGCAAAGG - Exonic
997312164 5:132896059-132896081 GCATGTGCTGGCCAGTGTAGAGG - Intronic
998546117 5:143029310-143029332 CTGTGAGCAGGCCACTTCAGGGG - Intronic
999257357 5:150216954-150216976 GAGTGTGGAGGCCAGAGCAAAGG - Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004336790 6:14771369-14771391 GTGGGTGTAGCCCAGTCCAGCGG + Intergenic
1005416218 6:25603218-25603240 GTGTCTGCAGGACAGGGCTGGGG - Intronic
1005423765 6:25679490-25679512 GTGTGTGCAGGGGATTGAAGGGG + Intronic
1006146849 6:31964422-31964444 GTTTAGGCAGGCCAGTGCTGTGG + Intronic
1007303819 6:40889062-40889084 GAGTGTGCTGCCCAGAGCAGAGG - Intergenic
1008308415 6:49934196-49934218 ATGTATGCAGGTTAGTGCAGTGG - Intergenic
1008851256 6:56025159-56025181 GTATGTGCATTCCAGTGCACAGG - Intergenic
1009565812 6:65310035-65310057 GTGTGTATAGTCCAGTGCAATGG - Intronic
1011896206 6:92229196-92229218 TTCTCTGCAGGCCAGCGCAGTGG - Intergenic
1013297030 6:108766834-108766856 CTGTGTGCAGGCATATGCAGAGG - Intergenic
1014432960 6:121390767-121390789 CTGTGTGCAGGCCTGTGTTGGGG - Intergenic
1015550015 6:134402473-134402495 GAGTTTGCAGGGCAGTGCTGAGG - Intergenic
1015580644 6:134720836-134720858 GTGGGTGGAGGCCCTTGCAGTGG + Intergenic
1015902425 6:138081962-138081984 GTGTGTGGAGGACAAGGCAGTGG + Intergenic
1016991113 6:149929203-149929225 GTGTCTGCAGCAAAGTGCAGGGG - Intergenic
1017006216 6:150029480-150029502 GTGTCTGCAGCAAAGTGCAGGGG - Intergenic
1017530592 6:155288012-155288034 GTGTGTGCATTGCAGTGAAGCGG - Intronic
1017882949 6:158574053-158574075 GTGTCTTCAGCCCCGTGCAGAGG + Intronic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018254386 6:161903994-161904016 GTGTGAAGAGGCCAGTGCTGGGG - Intronic
1018288480 6:162265649-162265671 CTCTGTGCAGTGCAGTGCAGTGG - Intronic
1018370220 6:163161468-163161490 ATATGTGCAGGCCAGTACAAAGG - Intronic
1018428556 6:163704756-163704778 GTGACTGCAGGCCAGTCCACAGG - Intergenic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1018877710 6:167840054-167840076 GTGTGTTCAGGGCTGTGAAGAGG + Intronic
1019064157 6:169281980-169282002 GGGTCTGCAGGCCAGCTCAGCGG + Intergenic
1020774779 7:12439346-12439368 CTGTATGCAGCCCAGGGCAGTGG - Intergenic
1021605112 7:22402386-22402408 GGGTCTGCAGGCCTGAGCAGTGG - Intergenic
1024689666 7:51785705-51785727 AGGTGTGGAGGCCAGTGCAGTGG - Intergenic
1026738525 7:72964220-72964242 GGGTGTGCAGACCAGGACAGCGG - Intronic
1026789543 7:73322863-73322885 GGGTGTGCAGACCAGGACAGCGG - Intronic
1026811938 7:73474733-73474755 TTGTGCCCAGGCTAGTGCAGTGG - Intronic
1027105209 7:75400849-75400871 GGGTGTGCAGACCAGGACAGCGG + Intronic
1027707785 7:81555651-81555673 GTGTGGGCAGGCCTGAGCATAGG - Intergenic
1027730170 7:81861057-81861079 GTGCGTGCAGGCTGGCGCAGTGG - Intergenic
1028202968 7:87984253-87984275 CTGTCTGCAGGTCACTGCAGGGG - Intronic
1028960227 7:96740358-96740380 GAGAGTGCAGCCCAGAGCAGAGG + Intergenic
1029655681 7:101922842-101922864 CTGTGGCCAGCCCAGTGCAGAGG - Intronic
1030115962 7:106062550-106062572 GTGGGAGCAGGCCTGAGCAGCGG + Intergenic
1030409722 7:109160794-109160816 CTGTGTGCAGGGCACTGCAGGGG - Intergenic
1032552436 7:132797040-132797062 GTGTGTGCAGGCAGGAGTAGAGG - Intronic
1033983674 7:147196809-147196831 GAGTGTGCAGGCGAGTGCAATGG + Intronic
1034270608 7:149801956-149801978 GTATGTGCCAGCCAGGGCAGGGG + Intergenic
1034400393 7:150857958-150857980 GGGTGTGCAGGCGAGTGCCGTGG - Exonic
1034424536 7:151007575-151007597 GGGGGTGCAGGGCAGGGCAGGGG + Intronic
1038053554 8:23836437-23836459 GTGTGTGCAGGCCAGTGAGGTGG + Intergenic
1038609357 8:29045579-29045601 GTGTGAGCAGGACAGGGCACTGG - Intronic
1041035945 8:53790654-53790676 GAGTGTGCTGGCATGTGCAGTGG - Intronic
1041473184 8:58233901-58233923 CTGTGAGGAGGCCATTGCAGGGG + Intergenic
1041809449 8:61891068-61891090 GTGTCTGCAGGCCGGTGTGGTGG - Intergenic
1041843457 8:62298544-62298566 GTGGCTGCAGTGCAGTGCAGTGG - Intronic
1042540600 8:69903967-69903989 TTGTGTTCAGGCTGGTGCAGTGG - Intergenic
1043570369 8:81595994-81596016 GTATGGGCAGGGCATTGCAGGGG - Intergenic
1043574940 8:81646204-81646226 GTATGGGCAGGGCACTGCAGGGG - Intergenic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1045870762 8:106924347-106924369 GTGTGTGGAGGGGAGGGCAGGGG + Intergenic
1046373972 8:113351042-113351064 GTGTGTGCATGCCAGTGCTATGG - Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049189084 8:141276633-141276655 GTGAGTGCAGTGCTGTGCAGAGG - Intronic
1049197453 8:141323572-141323594 GTGTGTGTGTGCCTGTGCAGTGG - Intergenic
1049307341 8:141911356-141911378 GAGTGTGCAGCCCTGTGGAGGGG - Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049804539 8:144532938-144532960 GGGTGTGCAGGCCAGGAGAGAGG - Intronic
1050184559 9:2959340-2959362 GTGTGTATAGCACAGTGCAGTGG + Intergenic
1050547814 9:6723571-6723593 GGGAGTGCAAGGCAGTGCAGAGG - Intronic
1052238296 9:26240119-26240141 GTGTGTGTAAGCCAATGCAGAGG - Intergenic
1052790699 9:32873219-32873241 GTGTGTTCAGTGCAGGGCAGGGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053062355 9:35042322-35042344 GTGTCTGCAGGCTAGGGCATGGG - Exonic
1056097137 9:83266822-83266844 GGGTGAGCAAGCCAGTGCAAAGG - Intronic
1056760005 9:89407747-89407769 GTGTAGCCAGGACAGTGCAGTGG - Intronic
1056831100 9:89918165-89918187 GTGTGTGCTGGCCACTGCCCTGG - Intergenic
1057461145 9:95263231-95263253 GTGTGTGCAGCCCTGTTCTGAGG - Intronic
1058940845 9:109811368-109811390 GTGGGTGCGGGGCAGTGAAGGGG + Intronic
1060402432 9:123356456-123356478 GTGGGTGCAGGCCTGAGCTGTGG + Intronic
1060430139 9:123543908-123543930 GTGTGTGCAAGTCAGTGCCCTGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060991736 9:127853553-127853575 GTGGGTGCAGGCCAGGTTAGGGG - Intronic
1060996148 9:127875781-127875803 GGGTGTGCAGGGCTGTGGAGAGG - Intronic
1061361192 9:130143345-130143367 GAGTGGGCGGGCCAGTGCCGAGG - Intergenic
1062022872 9:134327312-134327334 TTGTGAGCAGGACAGCGCAGAGG + Intronic
1062145694 9:134988509-134988531 GTGTCTGGAGGCCACAGCAGAGG - Intergenic
1186253410 X:7693651-7693673 TTATGTGCAGTACAGTGCAGAGG - Intergenic
1186788950 X:12978395-12978417 GTGTGTACAGGCTGCTGCAGAGG + Intergenic
1187614874 X:20981863-20981885 GTGAGTGCATGCCAGTAAAGTGG - Intergenic
1189498544 X:41531701-41531723 GTCTGTGCAGTCCAGTACAGTGG - Intronic
1189764563 X:44357115-44357137 ATCTGTGCTGTCCAGTGCAGTGG - Intergenic
1191076854 X:56463216-56463238 GTGTGTGCACCCCAGTGGAGGGG - Intergenic
1192198795 X:69050413-69050435 CTGTGTGGAGGCCATTGCTGGGG - Intergenic
1195573600 X:106424402-106424424 GTGTGGGAAGGCCAGTTAAGAGG - Intergenic
1195899561 X:109783235-109783257 GTGTGTGCGGGGCAGGGAAGAGG - Intergenic
1197561262 X:128024840-128024862 GTGTGTGCAGGCTAGGGATGTGG - Intergenic
1198383677 X:136107337-136107359 GTGGGAGCAGGCCCGAGCAGTGG - Intergenic
1199285605 X:146051029-146051051 GTGTGTGCAGTCCAGGACACAGG + Intergenic
1199982889 X:152930578-152930600 GGGTGTGCAGGCCAGTATAAAGG + Intronic
1202281995 Y:23199184-23199206 GTGTGTGCTGGCCAGTGCCTGGG + Intergenic
1202283896 Y:23219335-23219357 GTGTGTGCTGGCCAGTGCCTGGG - Intergenic
1202433667 Y:24813569-24813591 GTGTGTGCTGGCCAGTGCCTGGG + Intergenic
1202435572 Y:24833721-24833743 GTGTGTGCTGGCCAGTGCCTGGG - Intergenic