ID: 1085743402

View in Genome Browser
Species Human (GRCh38)
Location 11:79095354-79095376
Sequence TAAGTGTGGGGTACTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 364}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085743402 Original CRISPR TAAGTGTGGGGTACTGTGCA AGG (reversed) Intronic
900477070 1:2880913-2880935 TGAGTGTGTGGTGCTGGGCAGGG + Intergenic
901873360 1:12151687-12151709 TATGTGTTGGGCACTGTGCTTGG + Intergenic
902317025 1:15629316-15629338 TAAGTGTGAGCCACTGTGCCCGG - Intronic
903536157 1:24067737-24067759 CAGGTGTGGGGCACTGTGCCTGG + Intronic
903570663 1:24302428-24302450 TCAGTGTTGGTGACTGTGCAGGG + Intergenic
903723645 1:25424663-25424685 TAAGTGTGAGCCACTGTGCCTGG + Intronic
904019429 1:27451131-27451153 TAAGTGTGTGGCACAGTGCCTGG - Intronic
905691529 1:39946732-39946754 TAGGTGTGAGGCACTGTGCCTGG - Intergenic
906238555 1:44227325-44227347 TAGGTGTGGAGAACAGTGCAAGG + Intronic
906520179 1:46462103-46462125 GAGGTGGGGGGTGCTGTGCATGG - Intergenic
906708206 1:47910135-47910157 TACGTGTGAGCTACTGTGCCTGG + Intronic
907439852 1:54472475-54472497 CAAGTGTGGGCCACTGTGCCCGG + Intergenic
907716207 1:56928583-56928605 TGGCTGTGGGGTAATGTGCAAGG - Intergenic
908646812 1:66287384-66287406 TAAATGTTGGGCACTGTGCTGGG - Intronic
908761155 1:67513112-67513134 TAGGTGTGAGCTACTGTGCCCGG + Intergenic
909192972 1:72577605-72577627 TATGTGTCAGCTACTGTGCAAGG - Intergenic
909693052 1:78431897-78431919 CAAGTGTGAGCTACTGTGCCCGG + Intronic
910558890 1:88568407-88568429 TAGGTGTGAGCTACTGTGCCTGG - Intergenic
911516115 1:98870251-98870273 TAATTATGGGGTACTGTCAAAGG + Intergenic
911688775 1:100807745-100807767 AGAGCCTGGGGTACTGTGCAAGG + Intergenic
912356932 1:109061875-109061897 CAAGTGTGAGGCACTGTGCCTGG + Intergenic
912716177 1:111985219-111985241 TAAGTGTGTGGTACTGTGCCTGG - Intronic
917054210 1:170960904-170960926 TAGGTGTGTGGCACTGTGCCTGG + Intronic
917414608 1:174795851-174795873 TAGGTGTGAGCTACTGTGCCTGG + Intronic
917513810 1:175690222-175690244 TACGTGTGGGGTACTGTTATAGG + Intronic
918502680 1:185215815-185215837 CAGGTGTGAGGTACTGTGCCTGG + Intronic
918540411 1:185626045-185626067 CAAGTGTGAGGCACTGTGCCAGG - Intergenic
919716070 1:200777958-200777980 TAAGTGTGAGCCACTGTGCCTGG - Intronic
920414589 1:205790316-205790338 TATGTGTTAGGTACTGTGCCAGG - Exonic
921455676 1:215368184-215368206 TATGTGTCAGGTACTGTGCTGGG + Intergenic
921689493 1:218131730-218131752 TAAGTGTGAGCCACTGTGCCTGG - Intergenic
923552804 1:234977665-234977687 TAGGTGTGGGCCACTGTGCCTGG - Intergenic
1062785917 10:264529-264551 TAACTGTAGGGTACAGGGCATGG + Intergenic
1062785925 10:264588-264610 TAACTGTAGGGTACAGGGCATGG + Intergenic
1062785933 10:264647-264669 TAACTGTAGGGTACAGGGCATGG + Intergenic
1062785993 10:264999-265021 TAACTGTAGGGTACAGGGCATGG + Intergenic
1062786003 10:265058-265080 TAACTGTAGGGTACAGGGCATGG + Intergenic
1062786041 10:265292-265314 TAACTGTAGGGTACAGGGCACGG + Intergenic
1063743874 10:8857476-8857498 TAAGTGTGGGAGACACTGCAAGG + Intergenic
1065369219 10:24966136-24966158 TAAGTGTGAAGCACAGTGCAAGG + Intergenic
1065424401 10:25584696-25584718 TGAGTTTGTGGTACTGTGCCTGG - Intronic
1065657840 10:27970543-27970565 TATGTGTGGAGCACTGTGAAGGG - Intronic
1067740268 10:48890245-48890267 TAACTGTGGGATGCTTTGCATGG + Intronic
1068307375 10:55229868-55229890 TAAGAGTGGTGAAGTGTGCATGG - Intronic
1069513088 10:69056652-69056674 TGAGGGTGGGGGACTGTGCCTGG - Intergenic
1069951817 10:72024270-72024292 TAACTGTGGGGTACTGTGCCAGG - Intergenic
1070022822 10:72603538-72603560 TAGGTGTGAGCTACTGTGCCTGG - Intronic
1071893428 10:90038060-90038082 TATGTGTGGGGTACCATGCTGGG - Intergenic
1073174886 10:101549155-101549177 TAGGTGTGGGCCACTGTGCCTGG - Intronic
1073343229 10:102761824-102761846 TAAGTGTGAGCCACTGTGCCAGG + Intronic
1074917538 10:117971918-117971940 TAAGTGTGAGCCACTGTGCCTGG - Intergenic
1074933983 10:118159516-118159538 TAAATCTGGGGTTCTCTGCAGGG - Intergenic
1075032992 10:119039248-119039270 TAAGTGTGAGCCACTGTGCAGGG - Intronic
1075043476 10:119127179-119127201 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1075824754 10:125345997-125346019 TAGGTGTGAGGCACTGTGCCCGG - Intergenic
1076385542 10:130052424-130052446 TGGGTGTGGGGGACTGTGCTTGG - Intergenic
1078031452 11:7755689-7755711 TAAGTGTGAGCCACTGTGCCTGG - Intergenic
1078360416 11:10663499-10663521 TATGTGTTAGGTACTGTGCTGGG + Intronic
1079438492 11:20483615-20483637 TATGTGTGGGCTTCTGTGCTAGG + Intronic
1080063964 11:27987983-27988005 TATGTGTTGGGTACTATGCTTGG - Intergenic
1080245797 11:30177849-30177871 TATGTGTCAGTTACTGTGCAGGG - Intergenic
1080495191 11:32810851-32810873 TAAGTGTGAGCCACTGTGCCTGG - Intergenic
1080805864 11:35652941-35652963 TAAGTGTTGGTTACTTTCCATGG - Intergenic
1080815089 11:35747867-35747889 TAACTGGGGGGTACGGTGCGGGG + Intronic
1082045624 11:47723838-47723860 TAGGTGTGAGCCACTGTGCACGG + Intronic
1082825998 11:57579320-57579342 CAAGTGTGGGCCACTGTGCCTGG + Intergenic
1083133197 11:60646655-60646677 CATGTGTGGGGTACTATTCAAGG + Intergenic
1083458242 11:62793432-62793454 TAGGTGTGAGTTACTGTGCCTGG - Intronic
1083578534 11:63810159-63810181 TAGGTGTGCGCTACTGTGCCCGG - Intergenic
1084407927 11:68988724-68988746 TAAGTGTGAGTGGCTGTGCATGG + Intergenic
1084521338 11:69664857-69664879 TAAGAGTGGGCCACTGTGCTGGG + Intronic
1085187755 11:74590859-74590881 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1085743402 11:79095354-79095376 TAAGTGTGGGGTACTGTGCAAGG - Intronic
1087792922 11:102426061-102426083 TATGTGTTGGGCACTGTGCCAGG - Intronic
1087948275 11:104191949-104191971 TAAGTGTGAGCTATTGTGCCTGG + Intergenic
1088056376 11:105584694-105584716 TAGGTGTGAGCCACTGTGCATGG + Intergenic
1088394777 11:109354585-109354607 TATGTGTGAGGCACTGTGCTGGG - Intergenic
1089551727 11:119284549-119284571 CAGGTGTGGGCCACTGTGCATGG + Intronic
1091110212 11:132959544-132959566 GAAGAGTGGGGCACAGTGCAAGG + Intronic
1091346219 11:134856085-134856107 TATCTGTGGGGCACTGTGCTGGG + Intergenic
1091728508 12:2862817-2862839 TAGGTGTGAGCCACTGTGCATGG + Intronic
1092924081 12:13258157-13258179 TAAGTGAGGGTGACTGGGCAAGG + Intergenic
1092974797 12:13734314-13734336 TAACTTAGGGGCACTGTGCAGGG + Intronic
1096202185 12:49692492-49692514 TAACTGTGGTGAACTGTGGAGGG - Intronic
1096841444 12:54382009-54382031 TATGTGCTGGGTACTGTGCCTGG - Intronic
1098220421 12:68264417-68264439 TAAATGTGGGGTAGAGTGTAAGG + Intergenic
1100947698 12:99805344-99805366 TAGGTGTGGGCTACTGGGCCTGG - Intronic
1101003554 12:100379920-100379942 TAGGTGTGAGGCACTGTGCCCGG - Intronic
1101330444 12:103753519-103753541 TATGTGTCAGGGACTGTGCAGGG + Intronic
1101662389 12:106777138-106777160 TAGGTGTAAGGTACTGTGCCTGG + Intronic
1102134957 12:110566363-110566385 GCAGTGTGGGATACTGAGCAAGG + Intronic
1102372294 12:112392143-112392165 CAAGTGTGAGCTACTGTGCCTGG + Intergenic
1102603039 12:114047300-114047322 TACCTGTGGGGTACTGGGGAAGG + Intergenic
1103184680 12:118946252-118946274 TCAGTCTGGGGTGCTGTGCAGGG + Intergenic
1104076130 12:125391671-125391693 TACTTGTGGGGTTCTGTGTAGGG - Intronic
1104318930 12:127731867-127731889 TAAGTGTTGTGTTCTGTGCTGGG - Intergenic
1106211125 13:27647185-27647207 TATGTGTAAGATACTGTGCAAGG - Intronic
1106516297 13:30457264-30457286 TAAGTGTGAGCCACTGTGCCTGG + Exonic
1107027742 13:35820985-35821007 TATGTGTCAGGTACTGTGCCAGG - Intronic
1107045842 13:35991214-35991236 TAAGTGGGGGGAACTTAGCAAGG - Intronic
1107667831 13:42711124-42711146 TGAAAGTGGGGTACTGTCCAAGG + Intergenic
1108410156 13:50137681-50137703 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1110526452 13:76543761-76543783 TATGAGTGGGGTTCTGGGCAGGG - Intergenic
1112350082 13:98625996-98626018 TAAGTGTGAGCCACTGTGCCCGG - Intergenic
1114169784 14:20260966-20260988 TAAGTGTGAGCCACTGTGCCTGG - Intronic
1114752959 14:25226280-25226302 TAAGTGTCAGGTACTGTCCTAGG - Intergenic
1114838987 14:26239975-26239997 TATGTGTTGGGTACTGTTCTGGG - Intergenic
1115327471 14:32157066-32157088 TAAGTTTGGGGGAAGGTGCAAGG - Exonic
1115989768 14:39140162-39140184 TAAGTGTGAGCCACTGTGCCTGG + Intergenic
1116623633 14:47238349-47238371 TAAGTGTGAGGCACTGTGCTGGG - Intronic
1117164910 14:53023377-53023399 TAAGCGTGGGAGACTGTGCATGG - Intergenic
1117254028 14:53960325-53960347 CAAGTGAGGGGTATTGTGGATGG + Intergenic
1117832663 14:59768199-59768221 TAAGTGCTAGGTACTGTGCTAGG - Intronic
1117897395 14:60501906-60501928 TATGTGTCAGGCACTGTGCAAGG + Intronic
1118212620 14:63779632-63779654 CAAGTGTGGGCCACTGTGCCCGG - Intergenic
1119284550 14:73442070-73442092 CAAGTGTGAGCTACTGTGCCGGG - Intronic
1119346314 14:73927660-73927682 TATGTGTGGGGCATTCTGCAGGG + Intronic
1119858648 14:77920925-77920947 TAGGTGTGGGCCACTGTGCCTGG + Intronic
1120836978 14:89048385-89048407 TAAGTGTGAGCCACTGTGCCTGG + Intergenic
1121204782 14:92154099-92154121 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1121364135 14:93290960-93290982 CAAGTGTGGGCCACTGTGCTAGG + Intronic
1122167055 14:99834574-99834596 CAAGTGTGAGGTACTGTGCCCGG + Intronic
1122683539 14:103486159-103486181 TAGGTGTGAGGCACTGTGCCTGG - Intronic
1123631428 15:22262828-22262850 TAAGTGTTAGGCACAGTGCACGG - Intergenic
1124411130 15:29438226-29438248 TATGTGTTGGGGACAGTGCAAGG - Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1125569137 15:40701605-40701627 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1125913895 15:43467339-43467361 TAGGTGTGGGCTACTGCGCCCGG + Intronic
1125969040 15:43897195-43897217 GAAGTGAGGGGTGCTGGGCATGG + Intronic
1126138750 15:45418832-45418854 TAAGTGTGGGGTGGTGAGGAGGG + Intronic
1127085538 15:55421220-55421242 TAAGTGTGAGCCACTGTGCCTGG - Intronic
1127133854 15:55898022-55898044 TAATTGTGGGGTAATGTCAATGG - Intronic
1127226253 15:56932824-56932846 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1127709733 15:61584612-61584634 TAAGTGTTGGGTACTGTCCTAGG + Intergenic
1127997449 15:64161844-64161866 TAAGTGTGAGCCACTGTGCCTGG + Intronic
1128404769 15:67324332-67324354 TAAGTGTGAGCCACTGTGCTTGG - Intronic
1129932729 15:79425811-79425833 AAAGTGTGGTGTACTGACCAAGG - Intronic
1129967830 15:79752578-79752600 TAGGTGTGAGCCACTGTGCATGG + Intergenic
1130698685 15:86157065-86157087 TAAGTGTGAGCCACTGTGCCTGG + Intronic
1133030942 16:3010861-3010883 TAGGTGAGGGGCACTGAGCAGGG + Intergenic
1133036034 16:3034985-3035007 CAGGTGTGAGGTACTGTGCCCGG + Intronic
1133165710 16:3945849-3945871 TAGGTGTGGGCCACTGTGCCTGG + Intergenic
1133504285 16:6395785-6395807 CAAGCGTGAGCTACTGTGCAAGG - Intronic
1133731342 16:8581033-8581055 TGATTGTGGGGTGCTGTGGATGG - Intronic
1134372927 16:13642384-13642406 TATGTATGAGGTATTGTGCAAGG - Intergenic
1134461932 16:14437054-14437076 TCAGTGAGGAATACTGTGCATGG - Intronic
1134510282 16:14840942-14840964 TAGGTGTGAGGTGCTGTGCCTGG + Intronic
1134697923 16:16239431-16239453 TAGGTGTGAGGTACTGTGCCTGG + Intronic
1134816273 16:17208258-17208280 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1134973910 16:18555250-18555272 TAGGTGTGAGGTACTGTGCCTGG - Intronic
1135197302 16:20404857-20404879 TCAGTGTGGGGTGCTGGGTATGG + Intergenic
1136254195 16:29027394-29027416 TAAGTGTGAGCTACTGCGCCTGG + Intergenic
1136521829 16:30801740-30801762 CAGGTGTGGGCTACTGTGCCCGG - Intergenic
1138009857 16:53368234-53368256 CAAGTGTGAGCTACTGTGCCTGG + Intergenic
1140001623 16:71030706-71030728 TAGGCGTGGGCTACTGTGCCTGG + Intronic
1140389074 16:74569582-74569604 CAAGTGTGAGCCACTGTGCATGG - Intronic
1140801880 16:78495783-78495805 TAGGTGTGGGCCACTGTGCCCGG + Intronic
1141096744 16:81168336-81168358 TATGTGCTGGGCACTGTGCAGGG - Intergenic
1141500004 16:84437486-84437508 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1141971583 16:87487643-87487665 TAAGTGTTAGGCACAGTGCACGG + Intronic
1142423997 16:89991076-89991098 TTAGTGTGGGGCCCTGGGCATGG + Intergenic
1143131607 17:4681884-4681906 TAAGTGTGAGCCACTGTGCCTGG - Intronic
1143347130 17:6258098-6258120 TAAGTGTCAGGCACTGTGCTCGG - Intergenic
1143882930 17:10043635-10043657 TAGGTGTGAGCTACTGTGCCCGG - Intronic
1144747957 17:17628235-17628257 TAAGTGTGAGTCACTGTGCCTGG + Intergenic
1144868849 17:18355678-18355700 AAAGTGTGGAGCACTGTGCAGGG - Intronic
1148553431 17:48564190-48564212 TAAGTGTGGGGTGCGGAGCCGGG - Intronic
1149652758 17:58286822-58286844 TAGGTGTGAGCTACTGTGCCAGG - Intergenic
1150207143 17:63417647-63417669 TATGTGCCGGGAACTGTGCAGGG + Intronic
1151445742 17:74162398-74162420 TAAGTGTGAGCCACTGTGCCTGG - Intergenic
1151951252 17:77355457-77355479 AGAGTGTGGGCTAATGTGCAGGG - Intronic
1152059969 17:78065069-78065091 TAGGTGTGAGGCACTGTGCTTGG - Intronic
1152083603 17:78204175-78204197 TAGGTGTGAGCCACTGTGCAAGG - Intronic
1152486887 17:80600411-80600433 TAAATGTGGGGTACTTTTCATGG + Intronic
1152579260 17:81158887-81158909 TGACTGTGGGGCACTGTCCAGGG - Intronic
1153486562 18:5604729-5604751 TAGGTGTGAGCTACTGTGCCCGG + Intronic
1154941987 18:21123228-21123250 TAAGTGTGAGCCACTGTGCCTGG - Intergenic
1156947238 18:42849526-42849548 AAAGTGTGCAGTACAGTGCATGG + Intronic
1157281591 18:46349776-46349798 TAGCTGTGGGTTACTGGGCAAGG - Intronic
1157547370 18:48555838-48555860 TCAGTTTGGGGCACTGGGCATGG + Intronic
1157655914 18:49388059-49388081 CAAGTGTGAGCTACTGTGCCTGG - Intronic
1158319884 18:56250977-56250999 TGAGTGTGAGGCACTGTGCAGGG + Intergenic
1158758506 18:60355683-60355705 TAGGTGTGAGCCACTGTGCATGG + Intergenic
1160130071 18:76217817-76217839 TAGGTGTGAGCTACTGTGCCCGG - Intergenic
1161031967 19:2061715-2061737 GAAGTGTGGAGTAATGCGCACGG - Intergenic
1161454044 19:4361437-4361459 CAAGTGTGGGGTCCTGCTCAGGG + Exonic
1162010163 19:7808406-7808428 TAAGTATGGGGGGCTGGGCATGG + Intergenic
1162504299 19:11073820-11073842 TAGGTGTGAGGTACTGCGCCTGG - Intergenic
1162857739 19:13481991-13482013 TGAGTGTGGGGTCCTCTGCTTGG - Intronic
1163013048 19:14437235-14437257 CAAGTGTGAGGCACTGTGCCTGG - Intronic
1164617779 19:29677062-29677084 TCAGCCTGGGGTCCTGTGCATGG - Intergenic
1164802786 19:31091560-31091582 AAAGTGTGGGGGTCTGGGCAGGG - Intergenic
1165457113 19:35919035-35919057 TAAGTATGGGCTACTATGCCTGG + Intergenic
925688685 2:6497776-6497798 TATGTGTGGAGGACTTTGCAGGG - Intergenic
926619417 2:15033681-15033703 TAGGTGTGAGCTACTGTGCCTGG - Intergenic
927067957 2:19492944-19492966 TAAGTGGTGGGTACATTGCAGGG - Intergenic
928522976 2:32108726-32108748 TAGGTGTGAGCTACTGTGCCTGG + Intronic
928553054 2:32392916-32392938 TAAGTGTGAGACACTGTGCTAGG + Intronic
928714115 2:34040561-34040583 TAAGTGTCAGGTACTGTTCTCGG + Intergenic
928799817 2:35074021-35074043 TAACTGTTGGGTACTATGCTGGG + Intergenic
929196750 2:39192846-39192868 TAGGTGTGAGCTACTGTGCCGGG - Intronic
929750194 2:44703500-44703522 CAAGTGTGAGCTACTGTGCCTGG - Intronic
930671944 2:54160542-54160564 TATGTGCCAGGTACTGTGCAAGG - Intronic
930890477 2:56380415-56380437 TAGGTGTGTGCTACTGTGCCTGG - Intronic
931336343 2:61347649-61347671 TAGGTGTGAGCCACTGTGCATGG + Intronic
931344700 2:61435024-61435046 TAGGTGTGAGGTGCTGTGCTTGG - Intronic
931658661 2:64535620-64535642 TATGTGATAGGTACTGTGCAAGG - Intronic
931747690 2:65304479-65304501 TAGGTGTGAGGCACTGTGCCTGG + Intergenic
932514582 2:72332654-72332676 AAAGTCTGGGGTGCTGTACAGGG + Intronic
933357887 2:81236839-81236861 TAAGTGTGTGGTTTAGTGCAGGG + Intergenic
934127626 2:88913828-88913850 TAAGTGTGTGATAATTTGCATGG + Intergenic
935745738 2:106188748-106188770 TAAGAGTGGGGGACTCTGTAGGG - Intronic
935931883 2:108135464-108135486 GAAGTGTGGGGGAGTGTGTAAGG - Intergenic
938154455 2:128920713-128920735 TCAGTGTGGGGTATGGAGCAAGG + Intergenic
939593953 2:144101975-144101997 TAAGTGTGAGGTACTAATCAAGG - Intronic
939997160 2:148930664-148930686 CAAGTGTGGGGTACAGTGCCGGG + Intronic
940200186 2:151141722-151141744 TAAGTTTGAGGTACTCTGAATGG - Intergenic
940331379 2:152478511-152478533 TAGGTGTGAGCTACTGTGCCCGG + Intronic
941077344 2:161020793-161020815 TAGGTGTGAGGCACTGTGCCTGG - Intergenic
942180813 2:173378824-173378846 GAAGTGTGGGCCACTGTGCCCGG - Intergenic
942309983 2:174647233-174647255 CAAGTGTGTGACACTGTGCATGG - Intronic
943104657 2:183529459-183529481 TAAGTGTTGGGCAGTGAGCAGGG - Intergenic
943560442 2:189454965-189454987 TAGGTGTGAGGCACTGTGCCTGG - Intronic
943738203 2:191380832-191380854 TAGGTGTGAGGTGCTGTGTAAGG + Intronic
944716539 2:202380894-202380916 TAGGTGTGGGCCACTGTGCCTGG + Intronic
944758956 2:202793375-202793397 TAAGTGTGAGCCACTGTGCCCGG - Intronic
946368118 2:219263213-219263235 TAGGTGTGAGGCACTGTGCCCGG - Intronic
946737380 2:222767633-222767655 TAGGTGTGGGCCACTGTGCTTGG - Intergenic
1172079405 20:32327820-32327842 CAAGTGTGAGCTACTGTGCTCGG - Intronic
1172904042 20:38355691-38355713 GCAGTGTGGGGCACTGAGCAAGG - Intronic
1173635610 20:44554357-44554379 TAAGTGTGAGCCACTGTGCAAGG + Intronic
1173760340 20:45554303-45554325 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1175530246 20:59670025-59670047 TAAGTCTTGGGTGCTGTGCAAGG + Intronic
1177232616 21:18342080-18342102 TTGATGTGGGATACTGTGCAAGG + Intronic
1177652056 21:23969599-23969621 TAAGTGTGGGAGGCTGTGGATGG - Intergenic
1178298565 21:31431524-31431546 TAAGTGTCAGGTACTGTTCTTGG - Intronic
1178769124 21:35485906-35485928 TAAGTGCAAGGTACTGTGCTAGG - Intronic
1179324454 21:40326753-40326775 AAAATGTGGGGTACAGTCCAGGG + Intronic
1182966277 22:34524447-34524469 GAAGTGTGGTGTATTGGGCATGG - Intergenic
1183993416 22:41614559-41614581 TAGGTGTGAGCTACTGTGCCCGG + Intronic
1184374456 22:44102964-44102986 TGCGTGTGGGGTCCTGTGCTGGG + Intronic
1184400489 22:44271063-44271085 TATGAGTGGGGTACTGAGCTAGG + Intronic
1184638141 22:45852167-45852189 TCAGTGTGTGGTACTTTGTATGG + Intergenic
1185385173 22:50528634-50528656 TGGGGGAGGGGTACTGTGCAGGG - Intronic
949514454 3:4794633-4794655 GAAGTGTGGGGCACTGGGGAGGG - Intronic
950502512 3:13373275-13373297 CAGGTGTGGGGACCTGTGCAGGG + Intronic
951538442 3:23760770-23760792 TATGTGTGGGGTTCTGTGCTTGG + Intergenic
952438225 3:33294559-33294581 TAGGTGTGAGGCACTGTGCCTGG - Intronic
953422554 3:42765806-42765828 TGAGTGTGGGGAACTATGAAAGG + Intronic
953675891 3:45001992-45002014 TATGTGTCAGGTACTGTTCATGG - Intronic
954454710 3:50591481-50591503 TACGTGTGGGTGCCTGTGCAAGG - Intergenic
955081430 3:55661113-55661135 TAAGTGTGTGGTAATGTGTTAGG - Intronic
955323707 3:57993548-57993570 TAGGTGTGAGCTACTGTGCCTGG - Intergenic
955754470 3:62213914-62213936 TAGGTGTGAGCCACTGTGCACGG - Intronic
955972473 3:64449162-64449184 TAAGTGTTGGCTACTATTCAGGG - Intergenic
958131315 3:89428664-89428686 TACGTGTAGGGCACTGTGCTAGG - Intronic
958649358 3:96917575-96917597 TAGCAGTGGTGTACTGTGCATGG - Intronic
958674692 3:97252644-97252666 TAAGAGTGGGGGAGTGTGCCAGG + Intronic
959740836 3:109717500-109717522 GAAGTGTAGGTCACTGTGCAAGG - Intergenic
960090599 3:113634516-113634538 TAGGTGTGGGCCACTGTGCCGGG - Intergenic
960805815 3:121582981-121583003 TAGGTGTGAGCCACTGTGCATGG + Intronic
961530400 3:127536920-127536942 AAAGAGTGGGGAACTGGGCAGGG - Intergenic
962095530 3:132288858-132288880 TATGTGTCGGGCACTGTTCAAGG - Intergenic
962563594 3:136633844-136633866 TAAGCGTGGGCTACTGTGCCTGG - Intronic
962571102 3:136714316-136714338 CAAGTGTGAGCTACTGTGCTTGG - Intronic
966720543 3:183058335-183058357 TAAGTGTGAGGCACTGTGCCCGG - Intronic
967357759 3:188591878-188591900 TAACTGTGAGGTACTTGGCATGG + Intronic
967526640 3:190502793-190502815 TAAGTGTGGTGTATTTGGCATGG + Intergenic
968834965 4:2956646-2956668 TGAGGCTGGGGTGCTGTGCACGG - Intronic
968891173 4:3369186-3369208 AAAGTGTGGGGGAGTCTGCAGGG - Intronic
969062557 4:4449326-4449348 TAGGTGTGAGCCACTGTGCACGG + Intronic
969150185 4:5162752-5162774 TAAGTTTGGGGTCCTTGGCAGGG - Intronic
969592941 4:8132215-8132237 GGAGTGAGGGGTTCTGTGCAGGG - Intronic
969666539 4:8560599-8560621 CCAATGCGGGGTACTGTGCATGG + Intronic
970909823 4:21262011-21262033 TAAGACTGGGGAAATGTGCAGGG - Intronic
971220527 4:24701502-24701524 TAAATATGTGGTACTGGGCAAGG - Intergenic
971482128 4:27124348-27124370 TAGGTGTGAGCTACTGTGCCTGG + Intergenic
971675936 4:29629720-29629742 TAAGTGTGTGCTTCTGAGCAAGG + Intergenic
971993944 4:33939097-33939119 TAAGTGTGTGCTACCGTGCTAGG - Intergenic
972171352 4:36349464-36349486 TATGTGCTGGGTTCTGTGCAGGG - Intergenic
972418384 4:38864719-38864741 TGAGTGAGGGGGGCTGTGCATGG + Intergenic
972707020 4:41554850-41554872 TAGGTGTCGAGCACTGTGCAGGG + Intronic
974376588 4:61085627-61085649 TGTGTATGGGTTACTGTGCATGG + Intergenic
975379601 4:73683704-73683726 TAACTGTGGGGTTTTTTGCAAGG - Intergenic
976249930 4:83039912-83039934 CAGGTGTGGGCTACTGTGCTTGG + Intronic
976259679 4:83134072-83134094 CAAGTGTGAGCTACTGTGCCTGG + Intronic
977729986 4:100339583-100339605 TAAGTGGCGGGTATTGTGTAAGG - Intergenic
980916320 4:139036370-139036392 TAAGTGTGAGCCACTGTGCCTGG + Intronic
982045641 4:151442976-151442998 TGGGTGTGGGGTGCAGTGCATGG + Intronic
982069503 4:151683033-151683055 AAAGAGTGGGGTTCTGAGCAGGG - Intronic
983065009 4:163199096-163199118 TAGGTGTGAGCTACTGTGCCTGG - Intergenic
983728579 4:170963446-170963468 TAGGTGTGAGCCACTGTGCATGG + Intergenic
984424189 4:179562794-179562816 AAAGTGTGTAGTACTGGGCAAGG + Intergenic
984676274 4:182551741-182551763 CAGGTGTGAGCTACTGTGCATGG - Intronic
985399009 4:189574861-189574883 TAGGTGTGAGGAACTGTGCCCGG + Intergenic
986763801 5:10904476-10904498 TAAGTGTAGGGTACAGTGTCTGG + Intergenic
987094837 5:14539463-14539485 TAAGTGTGAGCCACTGTGCCTGG + Intergenic
989567060 5:42911121-42911143 TATGTGTGGGCTGCTGTGCTGGG - Intergenic
990958236 5:61365067-61365089 TAAGCGTGGGCCACTGTGCCTGG - Intronic
991239302 5:64439239-64439261 CAAGTGTGAGCTACTGTGCCCGG - Intergenic
991899032 5:71438148-71438170 TAAGTGTTAGGTGCTGTGCTAGG - Intergenic
991920667 5:71653570-71653592 TAAGTGTGAGCCACTGTGCCTGG - Intronic
992154404 5:73940605-73940627 TAAATATGGGTTACTGTTCATGG - Intronic
997976445 5:138444309-138444331 TAAGAGTGAGGGGCTGTGCAGGG + Intronic
998705533 5:144755365-144755387 TAAATGTGGGTTAATGTGAATGG - Intergenic
999492843 5:152068543-152068565 TAAGTGCCAGGTACTGTGCTGGG - Intergenic
999656880 5:153819267-153819289 TATGTGCCAGGTACTGTGCAAGG + Intergenic
1000043352 5:157501506-157501528 TGAGTGTGGGCTACTGTGTCTGG - Intronic
1000692623 5:164342122-164342144 CAGGTGTGGGCTACTGTGCCAGG + Intergenic
1001632107 5:173183114-173183136 TAAGTGTGAGCCACTGTGCCTGG + Intergenic
1003929562 6:10910803-10910825 TAATTGTGAGGTATTTTGCAGGG + Exonic
1006051276 6:31346657-31346679 TAAGTGTGAGCCACTGTGCCTGG - Intronic
1008194167 6:48497849-48497871 TATGTGTGGGGTAGAGAGCATGG - Intergenic
1008644501 6:53500212-53500234 ACAGTGAGGGGTACTGTACAGGG + Intronic
1011650832 6:89504680-89504702 TAAGTGTGAGCTACTCTGCCTGG + Intronic
1013313026 6:108915231-108915253 TAGGTGTGAGTTACTGTGCCTGG + Intronic
1014426186 6:121309754-121309776 TAAGTGTGAGCCACTGTGCCTGG - Intronic
1015020029 6:128462104-128462126 TAGGTGTGGGCCACTGTGCTTGG + Intronic
1015378750 6:132542260-132542282 TAAGTGTAAGGCACTGTGCTAGG - Intergenic
1015625189 6:135174269-135174291 TTAGTGTTGGGCACTGTGCAAGG - Intergenic
1017104933 6:150878527-150878549 CAAGTGTGAGCTACTGTGCCCGG + Intronic
1017914445 6:158820250-158820272 TAAGTGTCAGGTACTGTTCCAGG - Intergenic
1019115822 6:169761357-169761379 TAAGTGTGCACTACTGTGCCTGG + Intronic
1019201508 6:170319979-170320001 TACGTGTGAGGTTCTGTGCTAGG + Intronic
1021694466 7:23262895-23262917 TAAGCGTGAGGCACTGTGCCCGG + Intronic
1021892275 7:25197317-25197339 TAAGTGTGAGCTACCGTGCCCGG + Intergenic
1021992319 7:26151083-26151105 CCAGTGCTGGGTACTGTGCATGG + Intergenic
1022348932 7:29548054-29548076 TATGTGTCAGGTACTGTGCTAGG + Intergenic
1023263312 7:38379795-38379817 TAAGTGTCAGTTACTGTACATGG - Intergenic
1023639217 7:42240954-42240976 TAACTGGGTGCTACTGTGCAGGG - Intergenic
1023938031 7:44753521-44753543 TAAGTGTGAGCCACTGTGCCTGG + Intronic
1024602554 7:50996685-50996707 AAACTGTTGGGTACTGTGCTAGG - Intergenic
1024707403 7:51975027-51975049 TAGGTGTGAGCCACTGTGCATGG + Intergenic
1024976827 7:55121095-55121117 GAAGTGTGTCATACTGTGCAGGG + Intronic
1025774075 7:64542974-64542996 CAAGTGTGAGCTACTGTGCCTGG + Intronic
1026950995 7:74346754-74346776 CAAGTGTGAGCCACTGTGCATGG - Intronic
1027114452 7:75467802-75467824 TATGTGTGAGGAACTGTGCTAGG + Intronic
1027162653 7:75813796-75813818 GGAGTTTGGGGTACTCTGCAAGG - Intronic
1027865553 7:83641294-83641316 TAAGTGTCAGGAACTGTGCATGG + Intronic
1028852963 7:95557234-95557256 GAAGTATGGGCTCCTGTGCAAGG + Intergenic
1029621088 7:101690251-101690273 GAAGCGTGGGGCCCTGTGCAGGG - Intergenic
1030031271 7:105371855-105371877 TAAGTGTGAGCCACTGTGCCCGG - Intronic
1032904390 7:136347652-136347674 CAAGGGTGGGGAAATGTGCATGG + Intergenic
1033069993 7:138193260-138193282 TAGGTGTGAGCTACTGTGCCCGG - Intergenic
1034156451 7:148959589-148959611 TAAGTGTGAGCCACTGTGCCTGG + Intergenic
1034385532 7:150737794-150737816 GAAGTGAGGGGATCTGTGCAAGG - Intronic
1036124042 8:6046911-6046933 TAAGTGCTGGGTACTGTGTTAGG + Intergenic
1036219257 8:6907415-6907437 TAAGCGTGAGCTACTGTGCCTGG + Intergenic
1036705763 8:11045363-11045385 TAGGTGTGAGCCACTGTGCATGG + Intronic
1038141086 8:24845772-24845794 TAGGTGTGTGGCACTGTTCATGG + Intergenic
1038557305 8:28532688-28532710 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1041053609 8:53960670-53960692 CAAGTGTGGGCTATTGTGAAAGG - Intergenic
1041963556 8:63648327-63648349 GGAGTGTGGGGGAGTGTGCAAGG - Intergenic
1042590176 8:70390487-70390509 TAGGTGTGAGGCACTGTGCCTGG - Intronic
1043863951 8:85354250-85354272 TAGGTGTGAGCTACTGTGCCTGG + Intronic
1044077734 8:87844229-87844251 TAAATGTGGGGAACTGTCTAAGG + Intergenic
1044935519 8:97290050-97290072 TAAGTATCAGGTACTGTGCTAGG + Intergenic
1046568592 8:115933520-115933542 TAAGTGTGTGGTATTCTACAAGG + Intergenic
1046715265 8:117560094-117560116 AAAGTGGAGGGTACTTTGCAAGG - Intergenic
1048041374 8:130732071-130732093 CAAGTGTGAGCTACTGTGCCTGG + Intergenic
1048235615 8:132687026-132687048 TATGGGTGAGGCACTGTGCATGG - Intronic
1049425576 8:142536549-142536571 GGAGTGTGGGGTGCTGTGCCAGG - Intronic
1049449626 8:142653652-142653674 CAAGTGTGGGCCACTGTGCCTGG + Intergenic
1049534139 8:143170230-143170252 TAAGAGTGGGGGACTGTGGGTGG + Intergenic
1050445488 9:5717565-5717587 TAGGTGTGAGCTACTGTGCCTGG - Intronic
1051432976 9:16999262-16999284 TAAGTGTGAGCTACAGTGCCTGG + Intergenic
1052209294 9:25882433-25882455 TACGTGTCAGGCACTGTGCAAGG + Intergenic
1056075543 9:83034875-83034897 TAGCTGTGAGGTACAGTGCATGG + Intronic
1056518325 9:87375916-87375938 TAAGTGTGAGCCACTGTGCCCGG - Intergenic
1056570700 9:87812203-87812225 TATATGCCGGGTACTGTGCAAGG - Intergenic
1056929182 9:90860651-90860673 GAGCTGTGGGGTGCTGTGCATGG + Intronic
1058095959 9:100860677-100860699 TAGGTGTGAGCTACTGTGCCTGG + Intergenic
1059237498 9:112774110-112774132 CAAGTGTCGGGCACTGTGCTAGG + Intronic
1059972621 9:119683241-119683263 TGTGTTTGGGGCACTGTGCAAGG + Intergenic
1060613283 9:124987997-124988019 TAAGTGTGAGGCACTGGGTAAGG + Intronic
1060899586 9:127245531-127245553 TAAGTCTGGGGTCCAGAGCAAGG - Intronic
1062301126 9:135870650-135870672 CAGGTGTGTGGTACTGTGCCTGG - Intronic
1185937895 X:4279820-4279842 CAAGTGTGAGCTACTGTGCCAGG - Intergenic
1188277101 X:28213984-28214006 TATGTGTCAGGTACTGTGCTAGG + Intergenic
1189078422 X:37942760-37942782 TAAGTTTGTGGTACTGGGCTGGG - Intronic
1189292852 X:39897972-39897994 GAAGTGTTGGGTGCTGAGCAGGG + Intergenic
1190112351 X:47600474-47600496 GAGGTGTGAGCTACTGTGCATGG + Intronic
1190489731 X:50969632-50969654 TAGGTGTGAGCTACTGTGCCTGG + Intergenic
1192558668 X:72110404-72110426 TAGGTGGCTGGTACTGTGCAGGG - Intergenic
1194446599 X:93995023-93995045 CCAGTGTTGGGTACTGAGCAGGG + Intergenic
1194666466 X:96682514-96682536 TAAGTGTGAGGTACTGTGCAAGG - Intergenic
1194812930 X:98407806-98407828 TGGGTGGGGGGTACTGTGCAAGG - Intergenic
1195430907 X:104788171-104788193 GCAGTTTGGGGTACTTTGCATGG + Intronic