ID: 1085748783

View in Genome Browser
Species Human (GRCh38)
Location 11:79140569-79140591
Sequence CTGCTCTGCCTGGCAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085748778_1085748783 -2 Left 1085748778 11:79140548-79140570 CCCACATTTCCCTTTTCTGGGCT 0: 1
1: 0
2: 1
3: 30
4: 330
Right 1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG 0: 1
1: 0
2: 3
3: 33
4: 262
1085748779_1085748783 -3 Left 1085748779 11:79140549-79140571 CCACATTTCCCTTTTCTGGGCTG 0: 1
1: 1
2: 1
3: 35
4: 438
Right 1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG 0: 1
1: 0
2: 3
3: 33
4: 262
1085748774_1085748783 9 Left 1085748774 11:79140537-79140559 CCTTTAAAATCCCCACATTTCCC 0: 1
1: 0
2: 2
3: 38
4: 323
Right 1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG 0: 1
1: 0
2: 3
3: 33
4: 262
1085748777_1085748783 -1 Left 1085748777 11:79140547-79140569 CCCCACATTTCCCTTTTCTGGGC 0: 1
1: 0
2: 3
3: 43
4: 373
Right 1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG 0: 1
1: 0
2: 3
3: 33
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085748783 Original CRISPR CTGCTCTGCCTGGCAGAAAC AGG Intronic
900364897 1:2307300-2307322 CTGCTCTCCCTGGCAGCAGCAGG - Exonic
902294619 1:15458212-15458234 CTGCTCTGCTTTAAAGAAACGGG - Intronic
902618899 1:17639151-17639173 CTGCTCGGCCTGGCAGAGACAGG + Intronic
902768315 1:18631262-18631284 CTGATGCGCCTGGCAGAACCCGG - Exonic
902979821 1:20114658-20114680 CTGCTCTTCCTGGAGGAAGCTGG + Intronic
903256628 1:22106547-22106569 CTGCCCTCCCTGGCAGCAAAAGG - Intergenic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
903754298 1:25650071-25650093 CTGCTTTGAGTGTCAGAAACTGG - Intronic
903811876 1:26039137-26039159 CTGCTCAGCCAGGCACCAACTGG - Exonic
905279764 1:36841639-36841661 CTGGGCAGCCTGGCAGAAAAAGG - Intronic
905452484 1:38065549-38065571 CAGCTCTGCCTGTCAGAAGCTGG + Intergenic
905714487 1:40136535-40136557 CTGCTCTAATTGGCACAAACAGG + Intergenic
906300434 1:44677750-44677772 CTGCTCTGCCCATCAGAGACTGG - Intronic
906634494 1:47399692-47399714 CTGCTCTGGGAGGCAGAACCTGG + Intergenic
907109112 1:51910294-51910316 CAGCTCAGCCTGGCACACACGGG + Exonic
907551383 1:55308141-55308163 CTGCTCTGCCTTGCAGTGGCTGG + Intergenic
908945102 1:69486183-69486205 CTCCTCTCCCTGACAGAAGCAGG - Intergenic
909868588 1:80707656-80707678 CTAGTTTGCCTGACAGAAACAGG - Intergenic
911451549 1:98068093-98068115 CTGCACTCCCTGGCAGAATATGG + Intergenic
912201197 1:107460325-107460347 CTGCTCTTACTGTCAGAAAGAGG + Intronic
912947421 1:114096577-114096599 CACCTCAGCCTGCCAGAAACAGG + Intronic
913200025 1:116488454-116488476 CTGCTGTGCCTGCCAGAATTTGG + Intergenic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915049878 1:153057470-153057492 CTGATCTGCCTTGGAGAACCTGG - Exonic
915517640 1:156422385-156422407 CTTTTCCGCCTTGCAGAAACTGG + Intronic
917659510 1:177164146-177164168 CTGCCCTGCCTCAAAGAAACAGG - Intronic
917787570 1:178475183-178475205 TAGATCTGTCTGGCAGAAACAGG - Intronic
922117330 1:222626872-222626894 CTGCTCACCCAGTCAGAAACAGG - Intronic
922226355 1:223649341-223649363 CTGCTGAGCCTGTGAGAAACAGG + Intronic
923028210 1:230224022-230224044 CTGCTCTGCCTGTCTCAAAGTGG - Intronic
923260511 1:232263741-232263763 TTGCTCTGCCTGACAGATAGGGG + Intergenic
924586793 1:245367376-245367398 CTGCTCTTCCTGGCTCACACAGG - Intronic
1062984495 10:1755098-1755120 CTGCCCTGCTTGGGAGAACCTGG + Intergenic
1065382355 10:25102982-25103004 CTTCTCTGCCAGGCAGCAAAGGG + Intergenic
1065862176 10:29881215-29881237 CTCCTCTGCCTTGGAGAAAAAGG - Intergenic
1068629301 10:59283594-59283616 CTCCACTGCCTGGCAGGAAGAGG + Intronic
1069565585 10:69461437-69461459 CTGCTCTCCCAGGCAGGAAGTGG - Intronic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1072012166 10:91311929-91311951 GAGCTCTGCCTGGGAGAAAGTGG - Intergenic
1072043829 10:91634935-91634957 CTGCTCTACCTGTGAGAACCTGG - Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1073493469 10:103871072-103871094 GTGGTCTGCCTTGCAGAACCTGG + Intergenic
1075566242 10:123506570-123506592 CTGCTCTACTTGGCAAAAGCTGG + Intergenic
1075681643 10:124337682-124337704 CTGCCCTGCCTGGCACTGACGGG + Intergenic
1075684596 10:124354656-124354678 CAGCTCTGCCTGGAAGCATCTGG - Intergenic
1076345469 10:129775944-129775966 CTGCTCTGAATGGCAGGACCTGG - Intergenic
1077339493 11:2019690-2019712 ATGCTCTGTCTCGCAGAAGCTGG + Intergenic
1077779961 11:5316698-5316720 CTCCTCTGTCTGGGAGAAGCAGG + Intronic
1078669086 11:13349037-13349059 TTCCTGTGTCTGGCAGAAACTGG - Intronic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1080703593 11:34667223-34667245 AATCTCTGCCTGGCTGAAACCGG + Intergenic
1082999670 11:59279964-59279986 CTGAACTGCCTGTCATAAACTGG + Intergenic
1083921813 11:65785422-65785444 CAGCTGTGCCTGGCACAAAGTGG - Intergenic
1084267792 11:68013863-68013885 CTGCTCTGATTGGGAGAAGCTGG - Intronic
1084404033 11:68960782-68960804 CTGCCCCGCCTGGCAGATCCGGG + Intergenic
1084418833 11:69050026-69050048 CTCCTCTGTCTGGAAGGAACTGG + Intronic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1088375963 11:109141712-109141734 CTGCTATGCCAGGCATTAACTGG - Intergenic
1088823240 11:113474411-113474433 CTGCACTGCCGGGTAGAAACGGG + Intronic
1089097498 11:115931365-115931387 GTGCTCTGTCTGGCAGACTCTGG - Intergenic
1090667048 11:128921346-128921368 CTGCTCTGCCTGCCAACACCTGG - Intergenic
1202822478 11_KI270721v1_random:74879-74901 ATGCTCTGTCTCGCAGAAGCTGG + Intergenic
1091658420 12:2362856-2362878 CAGCTGTGCCAGGCAGACACAGG + Intronic
1092181967 12:6452276-6452298 CTGCTCTGCCTGGCTCTATCTGG + Exonic
1094160635 12:27386330-27386352 ATGCTCTGCAGGGCAGAAGCAGG - Intronic
1094360566 12:29626229-29626251 ATGCTCTGGTTGGCAGAAATAGG + Intronic
1095446747 12:42289483-42289505 CTGCTTTGCCTGGCAGAGGGGGG - Intronic
1095724335 12:45435380-45435402 CTGGCCATCCTGGCAGAAACTGG - Intronic
1095964770 12:47859206-47859228 ATGGTGTGGCTGGCAGAAACAGG - Intronic
1097704996 12:62859135-62859157 ATGCTATCCCTGGAAGAAACAGG + Intronic
1100754647 12:97737649-97737671 CTGCTCTTCCTGGGAGCCACAGG + Intergenic
1100799802 12:98219224-98219246 TTGTTCTTCCTGGTAGAAACGGG - Intergenic
1101345550 12:103882921-103882943 GTGCTCTGCCTGGTAGACCCAGG - Intergenic
1102181474 12:110915812-110915834 CAGCTCAGCCTGGGAGAAACTGG + Intronic
1103725705 12:122996489-122996511 CTGCTCTGACTCTCAGACACCGG + Exonic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106461274 13:29972400-29972422 CTGCCCTTCCTGGTAGAAAAGGG - Intergenic
1109561300 13:64053249-64053271 CTTCTCTTCCTAGCAGATACCGG + Intergenic
1112384874 13:98930367-98930389 CTGCACTGGATGGGAGAAACTGG - Intronic
1112695416 13:101942994-101943016 CTGCTGTGCAGGGCAGAAAGTGG - Intronic
1113803144 13:113096716-113096738 CGGCTCTGCCGGGCACACACGGG - Intronic
1113985301 13:114310182-114310204 CTGCTCTGCCGGCCAGCACCAGG + Intergenic
1114408101 14:22475164-22475186 CTGCTCTGAAAGGCAGAAAGAGG + Intergenic
1115630893 14:35244120-35244142 CTGCTTTTCTTGGCAGAAATGGG - Intronic
1117059803 14:51950484-51950506 CTGCTCTGCCTGCCAGTCAGAGG + Intronic
1117065288 14:52007809-52007831 CTGCTCTGCTGGGCAGATGCAGG - Exonic
1118793471 14:69117411-69117433 CTGCTCTGTCTGGCAGGATCTGG - Intronic
1119308953 14:73630773-73630795 ATGATCTGCCTGGAAGAAAAGGG + Intergenic
1121147317 14:91595574-91595596 CTTCTGTGCCTGTCAGAAAATGG + Intronic
1122858094 14:104569591-104569613 ATTCCCTGCCTGGCAGACACCGG - Intronic
1123701713 15:22918910-22918932 CTCCTCTGCCTGGCACATGCCGG + Intronic
1124612430 15:31217079-31217101 CTGCTTTGTATGGAAGAAACGGG + Intergenic
1124882463 15:33655086-33655108 CTCCTCTTCCTGGGAGAAAGTGG + Intronic
1125679475 15:41522007-41522029 CTGCATGGCCTGGCAGAAGCAGG + Intronic
1127333884 15:57964987-57965009 CAGCTCTGCCTGGCAACAAGTGG + Intronic
1127499620 15:59544082-59544104 CTGCTGTTCCAGACAGAAACTGG + Intergenic
1127844316 15:62856491-62856513 CTGCACTGCCTGGCAGAGGCCGG - Intergenic
1128736472 15:70056602-70056624 CAGCTCTGCCTTGCAGAACAGGG - Intronic
1129237217 15:74230873-74230895 CTCCGGTGCCTGGCAGAACCAGG + Intergenic
1129332266 15:74833745-74833767 CAGCTCTGCCTGGCAGGCATTGG - Intergenic
1129786751 15:78314698-78314720 CTGCGCTTCCTGGCTGAACCTGG + Intergenic
1129964656 15:79723589-79723611 CTGCTCCTGCTGGCAGATACAGG + Intergenic
1130014709 15:80177635-80177657 CTTTTCTTCCTGGCAGGAACAGG + Intronic
1130913996 15:88290690-88290712 CTGCTCTGGGTGGCAGCACCAGG - Intergenic
1131181170 15:90241097-90241119 CTGCTCTGCCTGGAAGCAGCGGG + Exonic
1132619180 16:856288-856310 CTTCTCTGCCTGGCACCACCTGG - Intronic
1132958400 16:2608778-2608800 CTGCTCTGCTCGGCAGGAACTGG - Intergenic
1132971012 16:2688874-2688896 CTGCTCTGCTCGGCAGGAACTGG - Intronic
1134260409 16:12646835-12646857 CTGTTCTCCATGGCAGAATCTGG - Intergenic
1134358914 16:13511957-13511979 TTGCTCTGGCTGGCAGGAATAGG - Intergenic
1135400603 16:22163917-22163939 CTGCCCTGCATGGCATATACTGG - Intergenic
1135990956 16:27218492-27218514 TTGCCATACCTGGCAGAAACAGG - Intronic
1135992770 16:27228089-27228111 GGGCTCTACCTGTCAGAAACGGG - Intronic
1138140888 16:54567592-54567614 CTCCTCTTCCTGGGAGAAATGGG - Intergenic
1139417519 16:66825902-66825924 GTGCTGTGCCTGGCAGAAACTGG + Intronic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1139973346 16:70790192-70790214 CATCCCTGCCTGGCAGACACGGG - Intronic
1140729590 16:77843901-77843923 CTGCTCTCCCTGGCAGAGGAAGG - Intronic
1140734963 16:77890367-77890389 CTCCTCTGCCTGGCAGCAAAGGG - Intronic
1141175123 16:81713649-81713671 CTGCTCTGCCCCGCAGCAGCTGG + Intergenic
1142902528 17:3020917-3020939 TAACTCTGCCTGGCAGAATCAGG - Intronic
1144444560 17:15314927-15314949 CTGCACTGCCAGGCAGACAGGGG + Intronic
1144506342 17:15834442-15834464 CTGCTAAGCATGGCAGAAACTGG - Intergenic
1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG + Intergenic
1144879155 17:18422095-18422117 CTTCTCTCCCTGGGAGAGACAGG - Intergenic
1145056339 17:19706355-19706377 CTGCTCTGCCTGGCCCATGCTGG + Intronic
1145170519 17:20652375-20652397 CTGCTAAGCATGGCAGAAACTGG - Intergenic
1146228767 17:31090507-31090529 CTGCACTGACTGGCAGATGCAGG - Intergenic
1151337938 17:73451132-73451154 CTGCTCTGCCAGAGAGAAAGGGG - Intronic
1151448565 17:74182936-74182958 CCGCTCCTCCTGGCAGAGACAGG + Intergenic
1152747650 17:82048746-82048768 CTGGTGTCCCAGGCAGAAACAGG - Exonic
1153758492 18:8307271-8307293 TTGCACTTCCTGGCTGAAACAGG - Intronic
1157320743 18:46631970-46631992 CTCCTGTGCCTGGCAGACAGTGG - Intronic
1157626855 18:49057918-49057940 CTGCTCTGACTGGTGGAGACTGG + Intronic
1157711422 18:49852310-49852332 CTCCTCTACCTGGCAGAAGCTGG + Intronic
1159242041 18:65753692-65753714 CTGCTCTGCTTGTCAGACGCTGG - Intronic
1159949542 18:74472632-74472654 CTGCTCAGCCTGGCAGTCACTGG - Intergenic
1160266683 18:77344488-77344510 CTGCTCTGCAGGGCAGAGAGAGG - Intergenic
1162965064 19:14151611-14151633 GTGCTCTGCAGGGCAGAAAGGGG + Exonic
1163463548 19:17453675-17453697 CTGACCTGCCTGGGAGAACCTGG + Intronic
1163624803 19:18383024-18383046 CTGCCCTGTCCGGCAGATACTGG - Intronic
1164845007 19:31424567-31424589 TTTCTCTGCCTGGCAGACATAGG - Intergenic
1165212199 19:34244843-34244865 CTGCTCTCCCATGCACAAACGGG + Intergenic
1168121124 19:54253176-54253198 CTCCTCAGCCTGGAAGAAGCAGG + Intronic
1168474989 19:56669076-56669098 CTGCTCTGACTGGGAGGCACAGG + Intronic
926540808 2:14178832-14178854 CAGCTCTACATGGCAAAAACTGG - Intergenic
927501687 2:23587508-23587530 CTCCACTGCCTGGCAGGAGCTGG + Intronic
928682775 2:33719674-33719696 CTTCTCTGCCTGACAGAATTAGG + Intergenic
929578207 2:43065992-43066014 GTGCCCTACCTGGCAGAACCTGG - Intergenic
931235493 2:60409379-60409401 CTGCCCTGCCTGCCCTAAACCGG - Intergenic
931646294 2:64424842-64424864 CTCCTATGCCTGGCAGCAAATGG + Intergenic
932347949 2:71007775-71007797 CTCCTCTGCCTGGCACACACAGG - Intergenic
932460450 2:71878831-71878853 CTGGTCTGCCTGGAAGAGCCCGG - Intergenic
932664533 2:73686298-73686320 CTCCTCTGCCAGGGAGCAACAGG - Intergenic
934104656 2:88684685-88684707 CTCCTGGGCCTGTCAGAAACTGG - Intergenic
934616205 2:95772799-95772821 CTCTCCTGCCTGGCAGAAAGTGG - Intergenic
934644690 2:96051761-96051783 CTCTCCTGCCTGGCAGAAAGTGG + Intergenic
934838105 2:97607851-97607873 CTCTCCTGCCTGGCAGAAAGTGG + Intergenic
935177876 2:100665007-100665029 CTGCCCTGCCTGGCAGATGTGGG + Intergenic
936167792 2:110138830-110138852 CTGCTTTGCCTGGCAGGCATTGG + Intronic
936599483 2:113881773-113881795 CTGCCCTTCCTGCCTGAAACAGG - Intergenic
938201919 2:129379241-129379263 CCGCTCTGCCTGTCACAAAATGG - Intergenic
938373923 2:130791837-130791859 CTGCTGTGTCTGGCTGAGACAGG - Intergenic
938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG + Intergenic
939251437 2:139685777-139685799 CACCTCTGCTGGGCAGAAACAGG + Intergenic
940046412 2:149415346-149415368 CCCCTCTGCCTGGCTGAAAAAGG + Intronic
942530198 2:176901808-176901830 CTGGCCTGCCTTGCAGATACAGG - Intergenic
942961115 2:181830718-181830740 CTGCTCTCCCTGGCACACAGAGG - Intergenic
943893632 2:193323894-193323916 CTTCTCTGCTTGGCATGAACTGG - Intergenic
946406033 2:219492578-219492600 TGGCTCTGCCTGGCAGGAGCCGG + Exonic
948060974 2:235043120-235043142 CAGCTCTGCCCGGCAGAAAAAGG - Exonic
1169060160 20:2655224-2655246 CTACTCTGCCTGGAGGAAATGGG - Intronic
1170029051 20:11925146-11925168 CTGCTCTGCAAGCCTGAAACTGG + Exonic
1170664870 20:18378164-18378186 ATGCTCTGCCTTCCAGAAGCAGG + Intergenic
1170871120 20:20207517-20207539 CTGAGCTCCCAGGCAGAAACTGG + Intronic
1171451012 20:25236478-25236500 CTGCTCTTCCTGCCTAAAACGGG - Intergenic
1172674114 20:36655241-36655263 ATGGTCTGCCTGGCAGGTACAGG + Intronic
1172768794 20:37364968-37364990 CTCCTCTGGCTGGGAGAAACTGG - Intronic
1173075283 20:39812684-39812706 CTGCTTTGCCTGGCAGTAGCAGG - Intergenic
1177047144 21:16184556-16184578 TCGCTCTGCTTGGCAGAGACTGG + Intergenic
1178407364 21:32335662-32335684 GCTCTCTGCCTGCCAGAAACTGG - Intronic
1179364128 21:40739818-40739840 CTGAACTGCCTGCCAGAATCAGG - Intronic
1180972016 22:19820723-19820745 CTGCTCGGCTTGTCTGAAACAGG - Exonic
1181324821 22:22036726-22036748 CTTCTCTGCCTTGAATAAACAGG - Intergenic
1183028048 22:35081002-35081024 GTGTTGTGCCTGGCAGAAAGGGG + Intronic
1183934111 22:41252397-41252419 ATGCAGTGCCTGGCAGAAAATGG + Intronic
1185306291 22:50118997-50119019 CTGCTCTGCCTGGCAGCCGAGGG - Intronic
950727225 3:14924238-14924260 ATGCTCTGTCTGGAAGAGACTGG - Intronic
950933076 3:16810662-16810684 CTGCCATGCCTGGCAGGAAAGGG - Intronic
951089586 3:18556634-18556656 CTGCACTGTGTGGTAGAAACAGG - Intergenic
951461666 3:22957753-22957775 TTGCTCTGCCCAGCAGAAAGTGG - Intergenic
951807985 3:26667776-26667798 GTGTTGTGCCTGGCAAAAACAGG + Intronic
952406116 3:33006600-33006622 CTGCTCTGTCCAGCAGACACAGG - Intronic
953220145 3:40962306-40962328 GTGCTCTGTGTGCCAGAAACTGG - Intergenic
953710148 3:45263265-45263287 ATGCTCTGGCTGGCAGCAATAGG - Intergenic
954538775 3:51380318-51380340 CTCCCCAGCCTGGCAGAAGCTGG + Intronic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
962281367 3:134054422-134054444 CTGCTCTGCCTGGCTGGACCTGG - Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962453051 3:135537825-135537847 CTGAACAGTCTGGCAGAAACTGG - Intergenic
964656247 3:159069108-159069130 TTGCTCAGCCATGCAGAAACAGG - Intronic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
965803211 3:172515545-172515567 CTCCTCTGGCTGGCAAAATCTGG + Intronic
968266497 3:197367334-197367356 CTTCTCTGCCTTGTAGACACGGG + Intergenic
968799464 4:2732726-2732748 CTGCTCTGCCTGGCACACAGAGG - Intergenic
968914884 4:3493100-3493122 CTGCTCAGCCTGCCAGCAGCGGG + Exonic
969479692 4:7441364-7441386 CGGCTCTGCCAGGCAGAAGCAGG - Intronic
969694633 4:8727725-8727747 CTGGGCTGCCGGGCAGACACTGG + Intergenic
970372938 4:15426702-15426724 CTGAGCTCCCTGGCAGAGACTGG + Intronic
970445066 4:16116578-16116600 CTGCCCTGCCTGCCAGCACCTGG + Intergenic
973662237 4:53119963-53119985 CTCCTCTGCCTGTCATAACCAGG + Intronic
973909882 4:55568749-55568771 CTGCCCTTCCTGGTAGAGACAGG - Intronic
975442988 4:74434079-74434101 ATGCTCTGTCTAGTAGAAACAGG + Intergenic
976620025 4:87117946-87117968 CTGCTCTCCATGGCAGAGACAGG + Intronic
978032495 4:103952465-103952487 CTACTGTGCCTGTCAGAAAGTGG - Intergenic
981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG + Intergenic
982597768 4:157406943-157406965 CTGAACTGCCTGTCATAAACTGG - Intergenic
985519108 5:362933-362955 CTTCTGTGCCTGGAAGAAACTGG + Intronic
985715617 5:1458083-1458105 CTGACCTGCCTGGGAGAGACGGG + Intronic
985770323 5:1805860-1805882 CTGCCCTGCCTGGCCGCATCCGG + Intronic
985950733 5:3219809-3219831 CGGCTCTGCCTGGCAAAGCCGGG - Intergenic
987002854 5:13678139-13678161 CTGCTGTCCCTGAAAGAAACTGG + Intergenic
992716236 5:79513988-79514010 CTGCTCTGCCCGGCGGTAGCCGG - Exonic
993177083 5:84500890-84500912 CTGCTCTGAGTGGCAGAGCCCGG + Intergenic
993903286 5:93598446-93598468 CTTCTTTGCCTGGGAGAACCTGG + Intergenic
994079717 5:95694824-95694846 CTGCCCTCCCTGGTAGAAAGGGG - Intronic
994096670 5:95853574-95853596 TTGCTGTGCCTGGCAGCAGCAGG - Intronic
995902480 5:117086263-117086285 GTCCTCTGCCTGGCAGCGACAGG - Intergenic
998961423 5:147490961-147490983 CTCCTCTCCCTGACAGAAGCAGG - Intronic
999217368 5:149946518-149946540 CTGATATGACAGGCAGAAACCGG - Intergenic
999312718 5:150562169-150562191 CTGCTCTGCATGGCAGCAGAGGG + Intergenic
999354320 5:150910274-150910296 CCACTCTGTCTGGCAGGAACAGG - Intergenic
999366357 5:151026275-151026297 ATGCTCTGCCTGGCAATCACAGG + Intronic
1001270807 5:170310223-170310245 CAGCTGTACCTGGCACAAACTGG + Intergenic
1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG + Intronic
1002620151 5:180482508-180482530 CTGCACTGCCTGGCAACAGCGGG - Intergenic
1005083416 6:21980325-21980347 CTTTTCTGACTGGCAGTAACTGG - Intergenic
1006400968 6:33817131-33817153 CCGCTCAGCCTGGGGGAAACTGG + Intergenic
1007108854 6:39301451-39301473 CTGTGCTGCCTGGCAGGAGCTGG + Intronic
1007292580 6:40798613-40798635 CTGCTATCCCTGGCAGGAATGGG + Intergenic
1013111766 6:107070105-107070127 CTGCTCTGCCTCAAAGAAGCTGG + Exonic
1013139997 6:107323343-107323365 GTGCTGTGCCTTGCAGAGACAGG + Intronic
1013766847 6:113584522-113584544 CTGCTCTTCCTGCAAGACACGGG - Intergenic
1014624212 6:123705697-123705719 GTGCTATGCATGGCACAAACTGG - Intergenic
1016843147 6:148544426-148544448 CTGCTCTTTTTGGCAGGAACAGG - Exonic
1019088236 6:169501795-169501817 CTGCCCTGCCTGGTGGAGACGGG + Intronic
1019764122 7:2837104-2837126 ATTCTCTGCCTGGAAGAAGCAGG + Intronic
1026064006 7:67053270-67053292 CTAGTCTGACTGGCAGAAGCAGG + Intronic
1026449585 7:70515836-70515858 ATGCATTGCCTGTCAGAAACTGG - Intronic
1026714346 7:72774190-72774212 CTAGTCTGACTGGCAGAAACAGG - Intronic
1026868869 7:73838816-73838838 CTGCTGGGCCTGGCAGAGACGGG + Intronic
1026877395 7:73887380-73887402 CTGCCCTGCCTGGCAGCAGAGGG + Intergenic
1029662653 7:101973174-101973196 CTGCTTTTCCTGGCAGAGGCTGG + Intronic
1032969706 7:137146689-137146711 CAGCTCTGCCCGTCAGTAACAGG - Intergenic
1033361984 7:140644374-140644396 CTGCTCTGTGTGGAAGAAACAGG - Intronic
1034540784 7:151756630-151756652 TTGGTCTGTCTGGCAGGAACGGG - Intronic
1035036423 7:155898078-155898100 CTGATCTCCCAGGCAGAAACAGG + Intergenic
1037111485 8:15168602-15168624 CTTCTCTTCCTAGCAGATACCGG - Intronic
1037721802 8:21450629-21450651 CTTCTCTGGCTCCCAGAAACTGG + Intergenic
1040384720 8:46906595-46906617 GTGCTTTGCCTGGCAAAAGCTGG - Intergenic
1040738953 8:50548135-50548157 CTGCTATGCCAGGAAGAAAAGGG + Intronic
1041152131 8:54945363-54945385 CTGCTCTGCTTTGCTGAACCTGG + Intergenic
1041181663 8:55255839-55255861 CAACTCTGCCTGGCAGACAACGG - Intronic
1041788527 8:61663578-61663600 CTGCTTTGTTTGGCAGATACAGG - Intronic
1042741170 8:72048524-72048546 GTGCTGTGCAAGGCAGAAACAGG + Intronic
1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG + Intergenic
1044820527 8:96153099-96153121 CAGCACTGCTTGTCAGAAACAGG - Intronic
1047747455 8:127855502-127855524 CTGCTGGCCCTGGCAGACACTGG + Intergenic
1047957075 8:129984314-129984336 CAGCCCTGCCTGGGAGACACTGG - Intronic
1048842078 8:138575371-138575393 CAGCACTGCCTTTCAGAAACTGG - Intergenic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1049358866 8:142202368-142202390 CTGATCTGCCTGGCAGAGGGCGG - Intergenic
1049983816 9:929711-929733 CTGTTAGGCCTGGCACAAACAGG - Intronic
1050080329 9:1909057-1909079 CTTCTCTACCTTGCAGAAATAGG - Intergenic
1051062656 9:13062686-13062708 CTCCTCAGCCAGGCAGGAACAGG - Intergenic
1052803113 9:32988471-32988493 CTGCCCAGGCTGGGAGAAACAGG - Intronic
1054773550 9:69105456-69105478 CAGCTGTACCTGTCAGAAACAGG - Intergenic
1055381305 9:75709898-75709920 CTGCTCTGACTGGTGGAAACAGG + Intergenic
1056503826 9:87237330-87237352 CTGCTATACCTGCCAGAATCTGG - Intergenic
1057329364 9:94098331-94098353 CTGTTCTGCCTGACAGAGCCAGG - Exonic
1057646799 9:96884146-96884168 ATCCTCTGCCTGGCAGAAGTGGG + Intergenic
1059576227 9:115491722-115491744 CTGCTCCTCCTGGCAAAACCTGG - Intergenic
1059944037 9:119388142-119388164 ATGCTCTGGCTTGCAAAAACAGG - Intergenic
1060765916 9:126294951-126294973 CTGGACTGCCTGCCAGAGACAGG + Intergenic
1061736165 9:132661126-132661148 TTGCTCTGCCTTGCACACACAGG + Intronic
1061826755 9:133262593-133262615 CTCCTCTCCCTGGCAGGAACTGG - Intronic
1062093228 9:134689476-134689498 AAGCTGTGCCTGACAGAAACCGG - Intronic
1062283576 9:135763013-135763035 CTGCTCTGCCTGCCCCACACGGG - Intronic
1062637645 9:137500051-137500073 CGGCTCTGCCAGGCAGCCACAGG + Intronic
1188079972 X:25826977-25826999 CTTCTCTGACTGGTGGAAACAGG - Intergenic
1191880704 X:65841616-65841638 CTTCACTGGCTGGGAGAAACAGG + Intergenic
1192059346 X:67807431-67807453 CTGAGCTGCCTATCAGAAACTGG - Intergenic
1195336799 X:103862881-103862903 CTACTCTGACTGACAGAGACTGG - Intergenic
1197833602 X:130671681-130671703 CTGCTCTGGCTGGTAGGAAAAGG - Intronic
1198530433 X:137546485-137546507 CTGCTCTGCATGCCAGAAAGAGG - Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic