ID: 1085750231

View in Genome Browser
Species Human (GRCh38)
Location 11:79155099-79155121
Sequence CAAGCTACTCACTTGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085750231_1085750236 6 Left 1085750231 11:79155099-79155121 CCATTATCCAAGTGAGTAGCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1085750236 11:79155128-79155150 CTGAGACCACAACAGCCCCAAGG 0: 1
1: 0
2: 0
3: 24
4: 256
1085750231_1085750237 10 Left 1085750231 11:79155099-79155121 CCATTATCCAAGTGAGTAGCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1085750237 11:79155132-79155154 GACCACAACAGCCCCAAGGAAGG 0: 1
1: 0
2: 3
3: 14
4: 207
1085750231_1085750239 20 Left 1085750231 11:79155099-79155121 CCATTATCCAAGTGAGTAGCTTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1085750239 11:79155142-79155164 GCCCCAAGGAAGGCCTAGAGAGG 0: 1
1: 0
2: 4
3: 28
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085750231 Original CRISPR CAAGCTACTCACTTGGATAA TGG (reversed) Intronic
901896280 1:12315563-12315585 CAAGTTAGAAACTTGGATAAGGG + Intronic
910502731 1:87911449-87911471 CAAACTACCCACTTGAAAAATGG - Intergenic
910836312 1:91516444-91516466 CCTGCTATTCACTTGGATTATGG + Intronic
911386378 1:97180315-97180337 CCATCTGCTCACTTGAATAAAGG - Intronic
911841803 1:102692301-102692323 CAAGCTAGTTACTTAGGTAAAGG + Intergenic
915423519 1:155804666-155804688 CCAGCTACTCAGTGGGATAAGGG + Intronic
917371479 1:174298424-174298446 CAAGCTTCCTATTTGGATAAAGG - Intronic
918558457 1:185834392-185834414 CAAGCTACTCACATGGTTGTTGG + Intronic
919506710 1:198407996-198408018 CCAACTCCTCACTTTGATAAAGG + Intergenic
919962243 1:202483486-202483508 CAAACTACTCACTGGGATTTTGG - Intronic
922325920 1:224528433-224528455 CCAGCTACTCAGGTGGCTAAGGG - Intronic
1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG + Intergenic
1064135208 10:12744784-12744806 CCAGCTACTCACGAGGATAAGGG + Intronic
1064879570 10:20035579-20035601 CCAGCTACTCCCTAGGCTAAAGG + Intronic
1066557106 10:36626456-36626478 CAGGCTTCTGACTTGGTTAATGG - Intergenic
1069368169 10:67715260-67715282 CATGTTAATGACTTGGATAATGG + Intergenic
1070534814 10:77368370-77368392 CAAGCTACCCAACTGGAAAATGG - Intronic
1074116332 10:110459916-110459938 TAAGCCACTCACTTGGTTAGTGG + Intergenic
1078817649 11:14842622-14842644 CAAGCTACTCAGGTGGCTGAGGG + Intronic
1079914940 11:26357620-26357642 CAAGCTACAGACTGGGAGAAAGG - Intronic
1079972250 11:27049552-27049574 CAAGCTACTCAATTAAAAAATGG - Intronic
1081405519 11:42693240-42693262 CAATCTACTCATTTGAAAAAGGG + Intergenic
1082146815 11:48680521-48680543 CAAGCTACTCATGTGACTAAAGG + Intergenic
1085750231 11:79155099-79155121 CAAGCTACTCACTTGGATAATGG - Intronic
1092491612 12:8950227-8950249 CAAGGTACTCAACTGGAAAAAGG - Intronic
1093154778 12:15669003-15669025 TCAGCTACTCAGTTGGCTAAGGG - Intronic
1094318468 12:29158427-29158449 CAAACTGCTCATTTGGATGAAGG - Intronic
1095337656 12:41048090-41048112 CACCATACTCACTTGGCTAAAGG + Intronic
1095605254 12:44059884-44059906 CCAGCCTCTCACTTGGCTAAAGG + Intronic
1108203682 13:48066825-48066847 CAGGCTCCTCCCTTGCATAAGGG - Intronic
1108978883 13:56484319-56484341 CAAGATACTGATTTGGATTAAGG - Intergenic
1111578345 13:90189114-90189136 AAAGCTACTACCTTTGATAAGGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1117439605 14:55747250-55747272 CAAGTTCCTCACCTGGAAAATGG - Intergenic
1121160628 14:91736360-91736382 CCAGCTACTCAGTAGGCTAAGGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124849665 15:33324104-33324126 CAAGATACTCTTTTGGATTAAGG + Intronic
1127353550 15:58176064-58176086 CAAGTTATTCACTTGTAAAATGG + Intronic
1132094971 15:98976918-98976940 CATGCTCCTCACCTGTATAATGG + Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1132559503 16:586975-586997 CAAGCCCCTCACTTGGACAGAGG + Intergenic
1137501565 16:49015292-49015314 GAAGCTAATCACTGGGACAAAGG - Intergenic
1137802803 16:51276586-51276608 CCAGCTAATAACTAGGATAATGG + Intergenic
1141896598 16:86962550-86962572 CAAGCCACTCACTTGGAGCCCGG + Intergenic
1203140536 16_KI270728v1_random:1762465-1762487 CAAGCAACTGATTTAGATAAAGG + Intergenic
1144420701 17:15095446-15095468 CATTCTACTCATTTGAATAAAGG + Intergenic
1149735179 17:58987191-58987213 CCAGTTACTCATTTGGAAAATGG - Intronic
1150180765 17:63118722-63118744 CAAGCTACTCAATAGGGTGAGGG - Intronic
1151597038 17:75084547-75084569 TAAGCTACACACTGAGATAAAGG + Intergenic
1151658621 17:75507369-75507391 CAACCTACTCATCTGAATAATGG + Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1158828174 18:61247758-61247780 CAAGCCTCTCACCTGGATGATGG + Intergenic
1164900722 19:31919773-31919795 CAAAATACTAACTTTGATAAAGG - Intergenic
1167015288 19:46837342-46837364 CAATGTTCTCACTTGGAAAATGG + Intergenic
925280329 2:2679883-2679905 CAAGCTACTCATTTGGGGAACGG + Intergenic
936165491 2:110116242-110116264 CAGTCTCCTCACTTGGAAAAGGG - Exonic
936644807 2:114356640-114356662 CAATCTACTCACTTGACAAAGGG - Intergenic
938103700 2:128515147-128515169 CAGGCGACTCACTTGAATGAGGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939261893 2:139821187-139821209 CAATCTACTCACCTGGCAAAGGG - Intergenic
943140156 2:183972159-183972181 CATGCTACTCACTTGGGGATAGG + Intergenic
947550557 2:231042271-231042293 AAAGCATCTCACGTGGATAAGGG - Intronic
1170309256 20:14974931-14974953 CAAGCTAGACCCTTGGATAATGG + Intronic
1171370033 20:24656526-24656548 CCAGCTACTCACCTGGAGGAAGG + Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
949412838 3:3784440-3784462 CAAGGAAATCACATGGATAAAGG + Intronic
949761924 3:7480370-7480392 CAAGCTCCCCACTTGCAGAAGGG + Intronic
950570241 3:13795425-13795447 CCAGCTACTCCCTTGTCTAATGG + Intergenic
951604407 3:24416838-24416860 AAAGCTCCCCAGTTGGATAATGG + Intronic
952841981 3:37654296-37654318 CTATCTGCTCACTTGGATCAGGG - Intronic
955874359 3:63474521-63474543 CAAGGTACTCACTTGGGCCAGGG - Intronic
957460621 3:80514350-80514372 CAAGCCCCTCACTTTTATAAGGG - Intergenic
960480274 3:118179503-118179525 CAAGCTACTCAATGTGACAAAGG + Intergenic
960511757 3:118557606-118557628 TAAGGTACTCTCTTAGATAAAGG - Intergenic
961458575 3:127036320-127036342 CATGCTACTCACATGGACAAGGG - Exonic
973781245 4:54290058-54290080 GTAGCTACTGACTTGGAGAAGGG + Intronic
977526198 4:98148674-98148696 AAAGCTACTGTCTTGCATAATGG + Intergenic
985532960 5:444318-444340 AAAGCTACTCATGTGGAAAAGGG - Intronic
986234360 5:5893519-5893541 CAAGCCCCTCACCTGGAGAATGG - Intergenic
991941732 5:71859953-71859975 CAAGCTATTCAATTAGATATAGG + Intergenic
994685279 5:102942967-102942989 CAAGCCACCCTTTTGGATAATGG - Intronic
995015803 5:107307329-107307351 CAAGCTGGTCACTTGGCTCAAGG - Intergenic
997490802 5:134274285-134274307 CAAGGCACTCAAATGGATAATGG + Intergenic
999839654 5:155411559-155411581 CAAGCTACTACCTTGGATCTGGG + Intergenic
1001983838 5:176056975-176056997 CAATCTACTCACCTGACTAAAGG + Intronic
1002233635 5:177787083-177787105 CAATCTACTCACCTGACTAAAGG - Intronic
1004595717 6:17097579-17097601 CAGGATAATCACTTGGACAAAGG + Intergenic
1005375741 6:25180580-25180602 CAAGCTACAAACATGCATAAAGG - Intergenic
1006205443 6:32337507-32337529 CAAGTTACTCTGTTGAATAAGGG - Intronic
1008642717 6:53481127-53481149 CAACCTACTCACTTGACAAAGGG - Intergenic
1008643572 6:53489995-53490017 CAACCTACTCACTTGACAAAGGG + Intergenic
1009502797 6:64437568-64437590 AAATCTACTCACTTGTAAAATGG + Intronic
1009657191 6:66562321-66562343 CAAGCTACCCACATAGATACTGG - Intergenic
1013810337 6:114038177-114038199 CAATCTATTATCTTGGATAAAGG + Intergenic
1015659222 6:135555799-135555821 CAAGCTTCTCACTAGCAAAAAGG + Intergenic
1020905160 7:14054786-14054808 CAAGCTACTCAGTTGGCTGAGGG - Intergenic
1021693473 7:23252924-23252946 TGAACTACTCACTTGGCTAAAGG - Intronic
1024490342 7:49975268-49975290 CAAGCAACTCACTAGGATCTAGG + Intronic
1025914521 7:65854974-65854996 CAAGCTACTCAGTAGGCTGAGGG + Intergenic
1027776080 7:82465919-82465941 CAATTTTCTCACTTGTATAAAGG - Intergenic
1028034205 7:85959345-85959367 CCAGCTACTCAGGTGGCTAAGGG - Intergenic
1029559059 7:101290398-101290420 GAAGCTACTGCCTTGGATATCGG + Intergenic
1029921332 7:104268032-104268054 TAAGCTACTTTCTTGGATAGAGG + Intergenic
1032695068 7:134328516-134328538 AAAGCTACAAACTTGGATCATGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040469009 8:47720870-47720892 CCAGCTACTCAGGAGGATAAGGG - Intronic
1041841669 8:62279273-62279295 CAATCTACTCACCTGAAAAAGGG - Intronic
1041891969 8:62879413-62879435 CAATCTACTCATCTGGAAAAGGG - Intronic
1044121930 8:88408424-88408446 CAAGCCACTCAGATGGCTAATGG + Intergenic
1050870300 9:10559648-10559670 CAACCTACTCACCTGAAAAAGGG + Intronic
1056742014 9:89265222-89265244 CAACCAACTCACTTGCACAAAGG - Intergenic
1058916748 9:109574443-109574465 CCACCTACTCTCTTGAATAAAGG + Intergenic
1059057611 9:111000496-111000518 CCAGCTGCTCACTTGCACAAAGG + Intronic
1059666054 9:116447643-116447665 CAAGGTACTCACCTGTACAACGG + Intronic
1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG + Intergenic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1185555017 X:1014434-1014456 CAAGCAACTGATTTAGATAAAGG - Intergenic
1189360383 X:40345420-40345442 CAAGCTATTCACTTTAAAAATGG - Intergenic
1190988610 X:55522724-55522746 CCAGCTACACAATGGGATAATGG - Intergenic
1191855374 X:65621028-65621050 CCAGCTACTCAGGAGGATAATGG - Intronic
1193238919 X:79143280-79143302 CAAGCTACTCAGATGGCTGAGGG + Intergenic
1195720584 X:107863979-107864001 CAAGTTCCTCACTTGAAAAATGG - Intronic
1197190416 X:123641400-123641422 CAAGTTCGTCACTTGGAGAATGG - Intronic
1202297378 Y:23374398-23374420 CAAACTACTCACTGGGATTTTGG - Intergenic
1202573429 Y:26296199-26296221 CAAACTACTCACTGGGATTTTGG + Intergenic