ID: 1085751702

View in Genome Browser
Species Human (GRCh38)
Location 11:79167816-79167838
Sequence CTGTGGACACAGAAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 432}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085751702_1085751712 12 Left 1085751702 11:79167816-79167838 CCAGGCTCCTTCTGTGTCCACAG 0: 1
1: 0
2: 2
3: 42
4: 432
Right 1085751712 11:79167851-79167873 TGTGGCTGGGGCACCTACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 200
1085751702_1085751708 -2 Left 1085751702 11:79167816-79167838 CCAGGCTCCTTCTGTGTCCACAG 0: 1
1: 0
2: 2
3: 42
4: 432
Right 1085751708 11:79167837-79167859 AGGGCCTGCAAAACTGTGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 138
1085751702_1085751709 -1 Left 1085751702 11:79167816-79167838 CCAGGCTCCTTCTGTGTCCACAG 0: 1
1: 0
2: 2
3: 42
4: 432
Right 1085751709 11:79167838-79167860 GGGCCTGCAAAACTGTGGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 119
1085751702_1085751710 0 Left 1085751702 11:79167816-79167838 CCAGGCTCCTTCTGTGTCCACAG 0: 1
1: 0
2: 2
3: 42
4: 432
Right 1085751710 11:79167839-79167861 GGCCTGCAAAACTGTGGCTGGGG 0: 1
1: 0
2: 1
3: 24
4: 165
1085751702_1085751707 -6 Left 1085751702 11:79167816-79167838 CCAGGCTCCTTCTGTGTCCACAG 0: 1
1: 0
2: 2
3: 42
4: 432
Right 1085751707 11:79167833-79167855 CCACAGGGCCTGCAAAACTGTGG 0: 1
1: 0
2: 0
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085751702 Original CRISPR CTGTGGACACAGAAGGAGCC TGG (reversed) Intronic
900540817 1:3201819-3201841 CAGTGGACACAGAAGTGGGCGGG - Intronic
900790011 1:4673654-4673676 CTGTGGACACAGACGCGGCCAGG + Intronic
901144740 1:7057282-7057304 CTGTGCACACTGCAGGACCCAGG - Intronic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
903943322 1:26946390-26946412 GAGAGGACACAGAAGGAGCTGGG - Exonic
904041836 1:27589939-27589961 CTCTGGAGGCAGAATGAGCCTGG - Intronic
904261525 1:29290424-29290446 CTGTGGAGTCAGCAGGGGCCTGG - Intronic
904292912 1:29499156-29499178 CTGTGGAGTCAGCAGGGGCCTGG + Intergenic
904334349 1:29787284-29787306 AGGTGGACACAGAAGGACCCTGG - Intergenic
904412352 1:30332106-30332128 CTGTGGAGTCAGCAGGGGCCTGG - Intergenic
906257123 1:44358884-44358906 CTAAGGTCACAGATGGAGCCAGG - Intergenic
906688849 1:47779598-47779620 CTCTGGACACAGGAGGTGCTGGG + Intronic
907336897 1:53705684-53705706 CTGTTGTCTCAGAAGGAGTCTGG - Intronic
907454334 1:54565468-54565490 CTCTGGAGTCAGAAGGACCCAGG + Intronic
907629110 1:56062242-56062264 CTGTGGACATATAAAGACCCTGG + Intergenic
907695345 1:56721073-56721095 CTGTGAATACAAAAGGAGACTGG - Intronic
908186120 1:61654720-61654742 CTGTGGACACAGACGTGTCCCGG + Intergenic
910194226 1:84624048-84624070 GTGGGGACACAGAAGCAGCTGGG + Intergenic
910308484 1:85795666-85795688 CTCTGTACACATAAGGTGCCTGG - Intronic
912048757 1:105495443-105495465 CTGGGGACACTGAAGAAGCAAGG - Intergenic
913389621 1:118295898-118295920 CTGTGGAGAGAGAAGGTACCAGG - Intergenic
914804702 1:150983481-150983503 CTGTAGACCAAGGAGGAGCCAGG + Intronic
915086670 1:153394004-153394026 CTTTGGGGACAGCAGGAGCCAGG + Intergenic
916135205 1:161646655-161646677 CTGTGGACATAGCAGGAGAGTGG + Intronic
917336147 1:173926218-173926240 CTGTGAACAAAAAAGTAGCCAGG + Intergenic
919845602 1:201640248-201640270 CTGTGGACACTGCAGGTCCCCGG - Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
919935499 1:202248119-202248141 CGGTGGCCAGGGAAGGAGCCTGG - Intronic
920028963 1:203024590-203024612 CTGTTCACACAGAGTGAGCCTGG + Exonic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
920263284 1:204704045-204704067 CGGTGGCCACAGGAGGAGGCTGG + Intergenic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
920843570 1:209575211-209575233 CACTGCACAGAGAAGGAGCCAGG + Intergenic
922744895 1:228038206-228038228 CTGCGGCCCCAGGAGGAGCCAGG - Intronic
922919095 1:229285586-229285608 TTGAGGCCACAGAAGGAGTCAGG + Intronic
1062880621 10:975029-975051 TAGTGGACACACAAGGAGCCAGG - Intergenic
1063454861 10:6175946-6175968 ATCTGCACACAGAAGGATCCAGG + Intronic
1063675590 10:8138515-8138537 CAGGGGACAGAGAAGGGGCCTGG - Intergenic
1064142047 10:12798843-12798865 CTGTGCACACAGAAGAATCAGGG + Intronic
1064328519 10:14372817-14372839 TTGGGGGCACAGAAGGATCCTGG - Intronic
1066426032 10:35308581-35308603 GTCTGGACAGAGAGGGAGCCTGG + Intronic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067066924 10:43109375-43109397 CTGTGTGCACAGAAGAGGCCTGG + Intronic
1067695878 10:48535379-48535401 CTGAGGTCCTAGAAGGAGCCTGG - Intronic
1067720893 10:48727023-48727045 CTTTGGATACTGAAGAAGCCAGG - Intronic
1068175235 10:53448501-53448523 ATGTGGACACACAAGGAGTGAGG + Intergenic
1068858885 10:61826509-61826531 CTCTGGAGACAGATGGAGACTGG + Intergenic
1069097558 10:64278050-64278072 CATGTGACACAGAAGGAGCCAGG - Intergenic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1069725042 10:70572017-70572039 TTGTGGACCCAGGGGGAGCCAGG + Intergenic
1070517982 10:77225707-77225729 CTGTGGCCCCAGGAGGAGACAGG + Intronic
1070648764 10:78220084-78220106 CTGTGGACACAATGGGAGTCTGG + Intergenic
1070758926 10:79011131-79011153 CATACGACACAGAAGGAGCCTGG - Intergenic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1074693546 10:116028254-116028276 CTGGGGACAAATGAGGAGCCTGG - Intergenic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1076019115 10:127055957-127055979 GTATGGACCCAGCAGGAGCCAGG + Intronic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077183897 11:1228077-1228099 AGGTGGACTCAGAAGGGGCCTGG + Intronic
1077245545 11:1535550-1535572 GTGCGGCCTCAGAAGGAGCCAGG + Intergenic
1077393871 11:2311818-2311840 CTGGGGGCTCTGAAGGAGCCTGG - Intronic
1077506498 11:2932086-2932108 CTGTGGGCAGAGAAGCTGCCTGG - Intergenic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079506957 11:21163720-21163742 CTGAGGACACAGAAAAAGGCAGG - Intronic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1081242264 11:40721563-40721585 TTGTGGACACATAGGAAGCCTGG + Intronic
1081363074 11:42203719-42203741 ATGTGGACACACAAGGAGTGAGG - Intergenic
1081509163 11:43751451-43751473 CACTGGACAAAGCAGGAGCCGGG + Intronic
1081645572 11:44787945-44787967 CTGTGGACCTACTAGGAGCCTGG + Intronic
1082789100 11:57335286-57335308 CTGTGCTCACGGATGGAGCCAGG + Intronic
1082861193 11:57858220-57858242 CTGAGGAGAAAGATGGAGCCTGG + Intergenic
1083887683 11:65580851-65580873 CAGTGGACAGAGAAAAAGCCTGG - Intronic
1084346090 11:68549923-68549945 CTGTGGAGACAGCAGGAGTCTGG + Intronic
1085024880 11:73230569-73230591 CTGAGGAAACAGAAGCAGTCTGG + Intronic
1085465910 11:76723215-76723237 CTGTGTACAGATAAGGAGACAGG + Intergenic
1085720225 11:78905901-78905923 CGGTGGAGACAGACAGAGCCTGG + Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1087094076 11:94303744-94303766 CTGAGCACAAACAAGGAGCCAGG - Intergenic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1089302562 11:117507463-117507485 GTGTGGACACAGAAAAACCCAGG + Intronic
1089668544 11:120035726-120035748 CCAGGGACACAGAAGGAGCCAGG - Intergenic
1089846638 11:121463999-121464021 CTGTGAGGACAGAAGGAGCCAGG - Intronic
1089946596 11:122480209-122480231 CTCTGGACCCACCAGGAGCCTGG + Intergenic
1090283381 11:125477774-125477796 CCCTGGAGGCAGAAGGAGCCAGG - Intronic
1090652300 11:128817729-128817751 CTCTGTACACTGAGGGAGCCTGG - Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1090769799 11:129909767-129909789 CTGTGGAAACAGTAGCAGGCTGG - Intronic
1090887565 11:130892830-130892852 CTGGGGACTGAGAATGAGCCAGG - Intronic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093718487 12:22411176-22411198 CTGAGGTCAGAGAAGGAGTCAGG + Intronic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1095859834 12:46904812-46904834 GTGAGGACTTAGAAGGAGCCTGG - Intergenic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1101630452 12:106488110-106488132 CTGTGGGCTCAGAAGCAGGCAGG + Intronic
1102197526 12:111035344-111035366 CTGCGGACCCCGTAGGAGCCGGG + Intronic
1102607007 12:114075566-114075588 TTGTGGATACAGAAGATGCCCGG - Intergenic
1102955990 12:117059315-117059337 CCGGGGACACAGAGGGACCCGGG - Intronic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1104597741 12:130131640-130131662 GTGTGGGCACAGATGGTGCCAGG - Intergenic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1105505932 13:21009827-21009849 CTGGGGACACCTAAGGACCCAGG - Intronic
1105847191 13:24303321-24303343 GTGTGGACACAGACGATGCCAGG - Exonic
1107295746 13:38905486-38905508 ATGTGGACACATAAGGAGTAAGG - Intergenic
1107432516 13:40352614-40352636 CTGGTGACAAAGCAGGAGCCTGG - Intergenic
1107628977 13:42323760-42323782 GTGTTGACACCGAAGGAGGCTGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1112668983 13:101613336-101613358 CTGGGAACACAGGAGGACCCTGG - Intronic
1113110222 13:106814658-106814680 CTGTGACCACAGAAGGATCTAGG + Intergenic
1113229188 13:108194502-108194524 CTGTGGAGCCAGCAGGGGCCGGG + Intergenic
1113255388 13:108499848-108499870 CTGTGGCCAGAGAAAAAGCCTGG + Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1113999786 14:16403328-16403350 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1116938820 14:50770184-50770206 CTGTGAGCAAAGCAGGAGCCTGG + Intronic
1117241791 14:53841261-53841283 ATGTGCACACACAAGGAGGCAGG - Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118055368 14:62074255-62074277 GTGTGGAGACTGAAGGAGTCAGG + Intronic
1119540938 14:75437938-75437960 CTGTGGTCACCGAAGGGTCCGGG - Exonic
1120945689 14:89994613-89994635 CTGTGGGAACACAAAGAGCCAGG + Intronic
1121075131 14:91061098-91061120 CCGTGGACAGAGGAGGGGCCTGG + Intronic
1121318248 14:92974875-92974897 CTGTGGTCACAGGAGGAGCGGGG + Intronic
1121322694 14:93001782-93001804 CTGTGCTCTCAGGAGGAGCCAGG - Intronic
1121444809 14:93972176-93972198 CTGGGGACACACGAGGAGTCAGG + Intronic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122417065 14:101555061-101555083 CTCTGGGCACACAAGGAGTCAGG - Intergenic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1127361528 15:58248597-58248619 CTGTGGCCACAAGAGGAGACAGG + Intronic
1127370127 15:58331404-58331426 CTAGGGAGACAGTAGGAGCCGGG - Intronic
1128388138 15:67165107-67165129 CTGTGGGGACAGCAGGTGCCAGG + Intronic
1128562552 15:68678222-68678244 CTGTTGTCAGAGAAGGAGTCAGG + Intronic
1128805711 15:70529560-70529582 CTGTGCACATAGGAGGTGCCAGG - Intergenic
1128942861 15:71802610-71802632 CTGTGCACATTGGAGGAGCCGGG + Intronic
1130043501 15:80426261-80426283 CTTTGGTCACAGAAGGAGCTAGG - Intronic
1130111128 15:80966614-80966636 GAGTGGACACAGAGGCAGCCTGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131529551 15:93179969-93179991 GTGTGGACACGGAGGCAGCCAGG + Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1132678289 16:1129681-1129703 TTGTGGACTCAGCCGGAGCCTGG - Intergenic
1132826148 16:1906659-1906681 CTGAGGACACGAAAGGAGTCTGG + Intergenic
1134043433 16:11084829-11084851 CTGTGGAGAAAGAGGTAGCCGGG + Intronic
1134244900 16:12532748-12532770 CTGGGGACAGGGCAGGAGCCTGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134455260 16:14390702-14390724 CTGAGGTCACAAAATGAGCCAGG - Intergenic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1136021107 16:27440628-27440650 CTGTGGGCACAGACTGAACCTGG + Intronic
1138141956 16:54576401-54576423 CTGTGGCGCCAAAAGGAGCCAGG - Intergenic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1139527978 16:67528397-67528419 GTCTGGACCCAGAAGGTGCCAGG + Intronic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1141461167 16:84179588-84179610 CTGTCCACACAGGAGGAGCCAGG + Exonic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1142171338 16:88624294-88624316 CTGGGGACACGGCAGCAGCCGGG + Intronic
1144052826 17:11511749-11511771 CTTTGCACACAGAAGGAACGTGG - Intronic
1144202228 17:12952021-12952043 CGGGGGCCACAGGAGGAGCCAGG + Intronic
1144787909 17:17842074-17842096 CTGGGGGCACATAATGAGCCAGG + Intergenic
1147671589 17:42179997-42180019 ATGGGGACACTGAAGGTGCCTGG + Intronic
1147940215 17:44041481-44041503 CTGTGCTCACATAGGGAGCCAGG + Intronic
1148435704 17:47682837-47682859 CTGAGGAGAAAGATGGAGCCTGG + Exonic
1150773575 17:68061672-68061694 CTCCGGACACAGAATGAGGCTGG + Intergenic
1151423692 17:74015871-74015893 CTGATGACAACGAAGGAGCCTGG + Intergenic
1151529409 17:74695065-74695087 CTGGGGTCCAAGAAGGAGCCTGG + Exonic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151556950 17:74851506-74851528 CTGTGGGCACAAGAGGAGGCGGG + Intronic
1151596765 17:75082697-75082719 AAATGGACACAGAAGGAGACAGG - Intergenic
1151934894 17:77255527-77255549 CCGTGGAGACAGAGGGCGCCGGG - Intergenic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152206035 17:78974820-78974842 CTGTGGACACAGCAGATGGCAGG + Intronic
1152879605 17:82807677-82807699 CTGTGGCCGCAGAAGCACCCCGG + Intronic
1152921864 17:83069891-83069913 CTGTGGGCACAGAACCTGCCAGG + Intergenic
1153375253 18:4369890-4369912 CTATGGACACACAAAGGGCCAGG + Intronic
1153590962 18:6673861-6673883 TCGGGGTCACAGAAGGAGCCTGG + Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154055837 18:11013303-11013325 CTTTGAAGACAGAAGGGGCCAGG + Intronic
1154070888 18:11149977-11149999 CTGTGGACCCAGCAGAAGTCGGG - Intergenic
1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG + Intergenic
1157106315 18:44777635-44777657 CTGAGGACACAGGAGGTTCCTGG + Intronic
1157222882 18:45839910-45839932 TTGTGGCCACAGCAGCAGCCAGG - Intronic
1158517726 18:58144804-58144826 CTGTGGACATAGCAGTAGCAAGG - Intronic
1158774000 18:60555196-60555218 CTGTGGAGCCAGAAGGAGCTGGG + Intergenic
1160373268 18:78391485-78391507 CCGAGGACACAGCAGGTGCCGGG - Intergenic
1160672812 19:374214-374236 CAGTGGGGACAGGAGGAGCCCGG + Intronic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161125181 19:2551978-2552000 CTGTGAACACACAAGCAGTCAGG - Intronic
1161723923 19:5917800-5917822 CGGTGGCCCCTGAAGGAGCCAGG + Exonic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162880195 19:13653210-13653232 ATGTGGACACACAAGGAGTGAGG - Intergenic
1163458715 19:17423906-17423928 CTGTAAAGACTGAAGGAGCCAGG + Intronic
1163534482 19:17869308-17869330 CTGGGGACACAGCATGATCCAGG - Intergenic
1164593262 19:29517709-29517731 CTGTGGACACAGGAGTTTCCTGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165464268 19:35963366-35963388 CTGTGGACACAGACAGACCTGGG - Intergenic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1167109203 19:47448923-47448945 CTGGGGACACAGCAGTAACCAGG + Intronic
1167605158 19:50477903-50477925 CAGAGGACACAGAAGGCCCCAGG - Intronic
1168009439 19:53518896-53518918 CTGTGGCCATAAAAGGAGCAAGG - Intergenic
1168056019 19:53865911-53865933 CTGTGGACAGATAGGGAGTCGGG - Intergenic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168289832 19:55352248-55352270 TTGTGGTCAGAGACGGAGCCAGG + Exonic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
927490143 2:23515884-23515906 TAGTGGGCACAGAAGGAGCCTGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
931819885 2:65941224-65941246 ACCTGAACACAGAAGGAGCCTGG + Intergenic
932220717 2:69997023-69997045 AAGTGGACACACAAGGAGGCTGG + Intergenic
932806085 2:74784688-74784710 CTGTGGACACAGCAGGTTCTGGG + Intergenic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
934716926 2:96549876-96549898 CTCTGGACAGAGGAAGAGCCAGG + Intronic
935337938 2:102034444-102034466 CAGTGGGCTCAGAAGGATCCAGG - Intergenic
935976604 2:108584844-108584866 TTGGGGACATAGATGGAGCCAGG + Intronic
936316058 2:111425163-111425185 CTGGGGACTCAGGAGCAGCCTGG - Intergenic
937338672 2:121077184-121077206 CTGTGGCCGCGGAAGGGGCCGGG + Intergenic
937352932 2:121178468-121178490 CTGTGCAGTCAGAAGGTGCCTGG + Intergenic
937635808 2:124154187-124154209 CTTTTGAGCCAGAAGGAGCCTGG + Intronic
937961947 2:127466715-127466737 CTGTGCACTCAGAAGAAGGCTGG + Intronic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
939181654 2:138810096-138810118 TCCTGGCCACAGAAGGAGCCAGG - Intergenic
942195958 2:173520330-173520352 GTGTAGCCTCAGAAGGAGCCAGG + Intergenic
943102645 2:183507357-183507379 TTCTGGACACATAAGGAGGCAGG - Intergenic
943873150 2:193027640-193027662 ATGTGGACACACAAGGAGTGAGG + Intergenic
944357134 2:198804069-198804091 GTGTGTGCACAGAATGAGCCCGG - Intergenic
944416257 2:199482731-199482753 TTGTGGACACACAACTAGCCTGG - Intergenic
944464954 2:199991714-199991736 CTGGGGACAAAGAGGCAGCCAGG - Intronic
944731451 2:202521697-202521719 CTGTGGGGACAGTATGAGCCTGG + Intronic
946046998 2:216829629-216829651 CTCTTGATACAGCAGGAGCCTGG + Intergenic
947118944 2:226797756-226797778 GCGCGGACACGGAAGGAGCCTGG + Exonic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
948770841 2:240250638-240250660 CTGAGGACAGAGAAGGCACCTGG + Intergenic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169725795 20:8728631-8728653 CTAAGGACACACAAGGAGGCTGG - Intronic
1170529309 20:17274352-17274374 CTATGGATAGAGGAGGAGCCAGG - Intronic
1170805298 20:19624616-19624638 CTTTGGACACTGAAGGAGAGTGG - Intronic
1170911507 20:20575110-20575132 CTGTGGACACTGAAGAGCCCTGG + Intronic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171727206 20:28635479-28635501 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1171791925 20:29534792-29534814 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1171847899 20:30288847-30288869 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1171856416 20:30348092-30348114 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1172009504 20:31838151-31838173 CTGAGGGCACACAAGGAGCAGGG + Intergenic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173650985 20:44664050-44664072 CTTAGGATACAGAAGGAGCCAGG + Intergenic
1173786799 20:45799758-45799780 CTGTGGACACAGCAGTAACTAGG - Intronic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174277146 20:49412304-49412326 CTGTGGACACGTAAGGCCCCAGG - Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174531627 20:51219146-51219168 CTGGGGACTCAGAAGTAACCTGG - Intergenic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175794051 20:61760351-61760373 CTGTGGGCAAAGCCGGAGCCTGG - Intronic
1176313725 21:5221792-5221814 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1180128118 21:45805611-45805633 CTGTTGACACAAAAGCAGACAGG - Intronic
1180391546 22:12287901-12287923 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1180408199 22:12576853-12576875 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180762935 22:18222983-18223005 CTGTTGTCAGACAAGGAGCCAGG - Intergenic
1180772708 22:18401564-18401586 CTGTTGTCAGACAAGGAGCCAGG + Intergenic
1180804088 22:18651180-18651202 CTGTTGTCAGACAAGGAGCCAGG + Intergenic
1180806687 22:18718297-18718319 CTGTTGTCAGACAAGGAGCCAGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180929599 22:19579903-19579925 CTGTGGACACAGACTGAAACAGG - Intergenic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181544233 22:23592014-23592036 GCGTAGCCACAGAAGGAGCCTGG - Intergenic
1181769490 22:25115071-25115093 CCTTGGACACAGAAGCAGGCAGG - Intronic
1182513017 22:30832662-30832684 CCGTGATCACAGAAAGAGCCTGG - Intronic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183366376 22:37409256-37409278 CTGTGGGCACTCAAGGACCCTGG + Intronic
1184385417 22:44171564-44171586 CTGATGACACAGAATGGGCCAGG - Intronic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184806337 22:46796963-46796985 GTGGGGACACAGCAGGAACCAGG - Intronic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185224326 22:49644249-49644271 ATGTGGACAGAGAGCGAGCCAGG + Intronic
1203234546 22_KI270731v1_random:142552-142574 CTGTTGTCAGACAAGGAGCCAGG + Intergenic
950357624 3:12425196-12425218 CTGTGGCCCCCGAAGGAGACGGG + Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953411530 3:42693039-42693061 GTGGGGATACAGAAGGTGCCAGG - Intronic
953915070 3:46913892-46913914 CTGTGGACAGGGTTGGAGCCAGG + Intergenic
954385826 3:50243279-50243301 CTGTGGCCAAAGAAGGGGCCTGG - Intronic
955514200 3:59710467-59710489 CTTTGGACACAGAAGCATACTGG + Intergenic
955789331 3:62572244-62572266 ATGAGGAAACAGAAGGACCCAGG - Intronic
956681521 3:71785562-71785584 CTGTGGACACATAGGGGGCGGGG + Intergenic
958161338 3:89819232-89819254 CTGTGGAGTCAGAGGGGGCCTGG - Intergenic
958997932 3:100927301-100927323 CTTTGGAGCCAGAAGGAACCAGG + Intronic
959584031 3:108009234-108009256 CAGTAGACACAGAAGCACCCAGG + Intergenic
960152375 3:114263262-114263284 CTGTGGTCAGAGAAGGTGCTTGG + Intergenic
961331040 3:126138114-126138136 CTGTGGACTCAGATGGTCCCGGG + Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
961829823 3:129617743-129617765 CTGTGGAGCCAGAAGGATCTGGG + Intergenic
964604166 3:158541215-158541237 CTGAAGACTTAGAAGGAGCCAGG - Intronic
966324951 3:178743515-178743537 TTGTCAACACAGCAGGAGCCTGG - Intronic
966672809 3:182547479-182547501 CTGTGGGCACAGAACAAGCATGG + Intergenic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
968602824 4:1518404-1518426 CTGTGGCCAGTGAAGGAGGCCGG + Intergenic
968939262 4:3629637-3629659 CTCTGGACTCAGAGGGAGCCAGG - Intergenic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969571059 4:8008635-8008657 CTGTGAACGCAGCCGGAGCCAGG - Intronic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972870430 4:43291398-43291420 CTGTGGCCTCAGAAGGCCCCTGG - Intergenic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
983862672 4:172727180-172727202 CTATGGGCACACAAGGAGCTTGG - Intronic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985622430 5:962617-962639 TGGTGGACACAGCAAGAGCCTGG + Intergenic
985624959 5:980541-980563 CTGTGGCCAGAGAAAGAGGCTGG + Intronic
985729911 5:1541291-1541313 CTGTGCACACAGCAGGGCCCAGG - Intergenic
986032443 5:3906749-3906771 CTGTGGGACCAGGAGGAGCCAGG + Intergenic
986043245 5:4013174-4013196 CAGTGGACGCAGACAGAGCCCGG + Intergenic
987155128 5:15081552-15081574 ATTTGCACCCAGAAGGAGCCTGG - Intergenic
989568379 5:42923846-42923868 ATGTGGACACTGAAGGCGACTGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990982710 5:61616018-61616040 ATGTGGGCACTGAGGGAGCCGGG - Intergenic
992107495 5:73462072-73462094 ATGTGGACACACAAGGAGTGAGG - Intergenic
992569260 5:78038057-78038079 CGGTGGGCACAGAAGCAACCTGG + Intronic
993721334 5:91324479-91324501 ATGTGGACAGAGAAATAGCCAGG + Intergenic
996450316 5:123614397-123614419 CTCTGGACACAGACAGATCCTGG + Exonic
996742248 5:126811208-126811230 CTGTGGCCTCACAGGGAGCCAGG + Intronic
996823939 5:127660289-127660311 CTCTGGACAAGGAAGGAGGCAGG - Intergenic
998162742 5:139822621-139822643 CCTTGGACACAGAGGGAGGCCGG - Intronic
998171919 5:139877527-139877549 CTGTGGATAAACAAGGAGCCTGG + Intronic
998260932 5:140631568-140631590 CTGCGGGGATAGAAGGAGCCAGG - Intergenic
999643299 5:153693474-153693496 CTGTGGTCTCAGAGGCAGCCTGG + Intronic
999743095 5:154571786-154571808 CTGTGGAAACAAAAGGAACCTGG - Intergenic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001527026 5:172436393-172436415 CTGTGGCCGGTGAAGGAGCCCGG - Intronic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003112142 6:3259274-3259296 CTGTGGACCCAAGAGAAGCCTGG - Intronic
1003260637 6:4512429-4512451 CTGAGGAGACTGCAGGAGCCAGG + Intergenic
1006028026 6:31159599-31159621 CTGCGGCCCCAGCAGGAGCCTGG + Exonic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006214492 6:32428656-32428678 CTGTGGAACCAGGAAGAGCCAGG + Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007083673 6:39127515-39127537 CTGTGGAGACTGTGGGAGCCTGG - Intergenic
1010414434 6:75597656-75597678 ATGTTGACCCTGAAGGAGCCTGG + Intergenic
1010597844 6:77787148-77787170 CTGTGGACACTGAAGCAGCCAGG + Intronic
1012096571 6:94970087-94970109 GTGGGGACATAGATGGAGCCGGG + Intergenic
1012856276 6:104505977-104505999 CTGTGATCATGGAAGGAGCCTGG - Intergenic
1013386574 6:109637820-109637842 CTTGGGACACCAAAGGAGCCTGG - Intronic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1015274338 6:131368678-131368700 CTGTGCACACTGACAGAGCCTGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017638675 6:156468571-156468593 CTGTGGACACAAACAGGGCCTGG + Intergenic
1017681358 6:156867347-156867369 CTGAGGACATAGGAAGAGCCAGG + Intronic
1019488623 7:1300841-1300863 CGGTGCACAGAGACGGAGCCCGG + Intergenic
1019612241 7:1942372-1942394 CTGTGGTCACAGCAGCAGGCTGG - Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1022505157 7:30905191-30905213 CTGGGAACACCGAAGAAGCCAGG + Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1022957084 7:35390874-35390896 CTGTGGGGACTGAAGGAGCCGGG + Intergenic
1023403179 7:39805509-39805531 ATGTGTACTCAGAAGCAGCCAGG - Intergenic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1027320285 7:77006252-77006274 GTCTGGACACAGGAGGAGGCGGG + Intergenic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1028719270 7:94011174-94011196 TTCTGGACACAAAAGGAGGCAGG - Intergenic
1030343060 7:108402529-108402551 TTTGGGAGACAGAAGGAGCCTGG + Intronic
1030638509 7:111977456-111977478 CTGTGGACATAGAAATAGTCTGG + Intronic
1031034901 7:116778206-116778228 CTGTCAACACAGGCGGAGCCAGG - Intronic
1031290487 7:119928363-119928385 CTGTGGATTCAGAAGGTGCCAGG + Intergenic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034206582 7:149321339-149321361 CTGAGGAGAAAGATGGAGCCTGG - Intergenic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034372767 7:150614860-150614882 GTGAGGACTTAGAAGGAGCCTGG - Intergenic
1034672418 7:152868730-152868752 ATTTGGACACAGAAGCAGACAGG - Intergenic
1034964914 7:155384881-155384903 CCGTAGACAGAGCAGGAGCCAGG - Intronic
1035412575 7:158656914-158656936 CTCTGGACACTGAAGAAGCAGGG + Intronic
1036068696 8:5415228-5415250 CTGTGAGCACAGGAGGAGCTGGG + Intergenic
1036129728 8:6097850-6097872 ATGTGGACACACAAGGAGTGAGG + Intergenic
1036436833 8:8742696-8742718 ATCTGCACGCAGAAGGAGCCTGG + Intergenic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1037637824 8:20716313-20716335 GTGTGCTCACAGAAGGACCCTGG - Intergenic
1037974588 8:23200441-23200463 CTGTGGGAACAGAAGAAGGCAGG + Intronic
1038065664 8:23961385-23961407 CTATGGCCACAGAATGAGCTGGG - Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039480626 8:37870684-37870706 CTGTGGAAACAAAAGCAGTCAGG + Intronic
1039993040 8:42506266-42506288 CTGTGGACTCAGAAAGACCTGGG + Intronic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1040551181 8:48438846-48438868 CTGTGGACATGGAAAGAGCTGGG + Intergenic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041362363 8:57066844-57066866 CTGTGGCCACAGCAGGTGGCAGG - Intergenic
1041850957 8:62391923-62391945 CAGTTGAGACAGAATGAGCCAGG - Intronic
1042049928 8:64692402-64692424 CGGTGCACAGAGATGGAGCCCGG + Intronic
1042082266 8:65067978-65068000 CTGTGGTCAGAGAAGAAGCTTGG + Intergenic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1046938842 8:119911611-119911633 ATGTGTACACAGCAGGGGCCAGG - Intronic
1047184094 8:122616444-122616466 ATGTGGTGACAGAAGGAGGCAGG - Intergenic
1047215867 8:122875700-122875722 ATGTGGAAACAGAAGCTGCCTGG + Intronic
1047905090 8:129464459-129464481 CTGAGGGAACAGAAGCAGCCTGG - Intergenic
1048316278 8:133364916-133364938 ATGTGGACACACAAGGAGTGAGG - Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048810945 8:138285479-138285501 CTGTCGCTACAGAAGGAACCTGG - Intronic
1048846285 8:138606288-138606310 CTGAGGACACAGGAGGTGGCAGG + Intronic
1049351125 8:142165363-142165385 GTGTGGTCACTGAAGGAGCCAGG - Intergenic
1049381498 8:142318635-142318657 CTGGGGGCCGAGAAGGAGCCAGG + Intronic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049538325 8:143193429-143193451 CTGTGGAGGCAGAAGGACCTGGG + Intergenic
1049542454 8:143214729-143214751 CTGTGACCACGGCAGGAGCCTGG + Intergenic
1049641608 8:143718509-143718531 CTGTGGTCAGAGCAGGAGCCTGG - Intronic
1049781470 8:144430939-144430961 TGGTGGAAACCGAAGGAGCCAGG + Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1053174123 9:35909998-35910020 CTATGGATGCAGGAGGAGCCCGG - Intergenic
1053722542 9:40961623-40961645 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1053786034 9:41653497-41653519 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054159016 9:61660699-61660721 AGGTGGAGACAGAAGGAGTCAGG + Intronic
1054174750 9:61867430-61867452 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054343426 9:63890374-63890396 CTGTGGACTCAGATTGAGCCAGG - Intergenic
1054451492 9:65405684-65405706 CTCTGGACTCAGAGGGAGCCAGG + Intergenic
1054478790 9:65591704-65591726 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1054662788 9:67713363-67713385 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1056654142 9:88495487-88495509 CTGTGGACACTGCAGGGGACAGG + Intergenic
1056978352 9:91282568-91282590 CTGAGGTCAGAGAAGTAGCCAGG + Intronic
1059062752 9:111050821-111050843 CTGGGGAGACAGAAAGACCCTGG + Intergenic
1059153219 9:111967500-111967522 CAGCCGACACAGAAGCAGCCAGG - Intergenic
1059399535 9:114060271-114060293 CTGTGGACACAGAGAGACTCAGG + Intronic
1060219585 9:121757256-121757278 CTGTGGCCTCAGCAGGGGCCAGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060586380 9:124788836-124788858 CTCTGGACACAGGAGGACCTGGG - Intronic
1060751061 9:126169860-126169882 CTGGGGACAGAGGAGGAACCTGG + Intergenic
1060858029 9:126931072-126931094 CTTTGGACTTAGAAGGAACCTGG - Intronic
1061211228 9:129194579-129194601 CTTTGGAGGCAGAAGGACCCAGG + Intergenic
1062144177 9:134979665-134979687 CTGTGGAAACAGGAAGGGCCTGG + Intergenic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1188973482 X:36645992-36646014 ATGTGGACACACAAGGAGTGAGG - Intergenic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1194026964 X:88764462-88764484 CTGTGGAAACAGAAGGGATCAGG + Intergenic
1194352302 X:92835287-92835309 CTGTGGACCCACACAGAGCCAGG + Intergenic
1195107803 X:101617386-101617408 GTGTGGAGAAAGAAGGGGCCAGG + Intronic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1195614342 X:106900909-106900931 CTGTGGACAGAGAAGAAACATGG + Intronic
1195682050 X:107554537-107554559 CAGTGGACAAAGAAGCAGGCAGG + Intronic
1197790770 X:130251816-130251838 CAGAGGTGACAGAAGGAGCCAGG + Intronic
1197828203 X:130613264-130613286 CTGGTGCCACAGAATGAGCCAGG - Intergenic
1198843693 X:140886251-140886273 AGGTGGACAGAAAAGGAGCCTGG - Intergenic
1200395710 X:155986330-155986352 GTGAGGACTTAGAAGGAGCCTGG - Intergenic
1200660611 Y:5952025-5952047 CTGTGGACCCACACAGAGCCAGG + Intergenic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic