ID: 1085753961

View in Genome Browser
Species Human (GRCh38)
Location 11:79188647-79188669
Sequence AAGCAGAAGAGAAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1651
Summary {0: 1, 1: 0, 2: 9, 3: 169, 4: 1472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085753961 Original CRISPR AAGCAGAAGAGAAGTGAGGA TGG Intronic
900517172 1:3088001-3088023 AAACAGCAGTGAAATGAGGAGGG - Intronic
900622548 1:3593934-3593956 AAGGGGAAGAGAAGGGATGATGG - Intronic
900766409 1:4508866-4508888 AAGAAGAAGAGAAGAGAAGAGGG - Intergenic
901221629 1:7586875-7586897 AAGCACAATAGCAGTGTGGATGG + Intronic
902655936 1:17868371-17868393 GAGCAAGAGAGAAGGGAGGAGGG - Intergenic
902700020 1:18165870-18165892 AAGCAGAAGAGAACAAAGGAAGG - Intronic
902735113 1:18395449-18395471 AAGCAAGAGAGAAGGGAGGGAGG - Intergenic
903331782 1:22600302-22600324 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
904134227 1:28298792-28298814 AAGTAGAAGAGAAGGCAGGCCGG + Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904463242 1:30692811-30692833 AAGAGGAAGAGAAGAGAGGAAGG + Intergenic
904747930 1:32722491-32722513 AAGGAGAAAAGAAGGAAGGAAGG + Intergenic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
905307885 1:37032061-37032083 AAGAAGATTAGAAGAGAGGAGGG + Intronic
905445881 1:38028360-38028382 GAGCAGATGAGGAGAGAGGATGG - Intergenic
906562390 1:46768675-46768697 AAGGAGAAAAGAAGAGAGGGAGG + Intronic
906674205 1:47681429-47681451 AAGCAGGAGAGAGGGAAGGATGG + Intergenic
906782671 1:48586450-48586472 AAGCACAGGACAGGTGAGGAGGG + Intronic
906831593 1:49037484-49037506 AAGTAGAAGCCAAGTGAGGAGGG - Intronic
907077186 1:51589725-51589747 AAGCAGGAGATAAGAGAGGTAGG + Intronic
907112129 1:51935791-51935813 AAGGGGAAGAGAACAGAGGAAGG + Intronic
907523953 1:55042962-55042984 AAGCAAGAGAGAAGAGAGGGAGG - Intronic
907530072 1:55086182-55086204 AAGCAGAAGTGAAGTGACCTTGG - Intronic
908176106 1:61556578-61556600 AACTAGAAGAGAAGAGAAGAGGG + Intergenic
908256126 1:62305024-62305046 AAGCAGAAGAGATGTGAAAACGG + Intronic
908413933 1:63894030-63894052 AAGCACAAGAGTAGTGATGCTGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908594716 1:65674854-65674876 AAGCACAAGAGTAGTGATGCTGG + Intergenic
908779208 1:67673506-67673528 AAGAAGAAAAGAAGAAAGGAAGG + Intergenic
908792985 1:67801902-67801924 AAGTGGAAGAAAAGGGAGGAAGG + Intronic
908806187 1:67935875-67935897 AAGCACAAGAGTTGTGATGATGG + Intergenic
909007697 1:70296784-70296806 AAGCAGCAGAGAGGGAAGGAAGG + Intronic
909007969 1:70299458-70299480 AAGCAGATGAGAAGGGAGCCAGG + Intronic
909193692 1:72588389-72588411 AGGCAAAAGAGAAGTGAGGAAGG + Intergenic
909687571 1:78367989-78368011 AAGCAGAGGAAAGGAGAGGAGGG - Intronic
909772161 1:79437442-79437464 AAGAAAAAGAAAATTGAGGATGG + Intergenic
910087064 1:83416038-83416060 ATGCAGATGAGAGATGAGGAAGG + Intergenic
910211573 1:84798904-84798926 AAAGAGAAGAGAAGAGAGGGAGG + Intergenic
910258507 1:85273944-85273966 AATCTGAAGTGAAGTTAGGAAGG - Intronic
910376638 1:86579264-86579286 AAGGAAAAGACAAGTGAAGAAGG + Intronic
910380327 1:86620379-86620401 ATGCAGGAGGGAAGTGAAGACGG - Intergenic
910651150 1:89569456-89569478 AAGCAGAAAGGAAGGGAGGGAGG - Intronic
911070412 1:93827717-93827739 GAGAGGAAGAGAAGGGAGGAGGG + Intronic
911120994 1:94296359-94296381 AAGCACAAGAGTAGTGATGCTGG + Intergenic
911154856 1:94627417-94627439 AGGCAGAAGAGAAGTCAGAGTGG - Intergenic
911254139 1:95614825-95614847 AAGAATGAGAGAAGGGAGGAAGG - Intergenic
911281006 1:95928929-95928951 AAGATGAAGAGAATTGGGGATGG - Intergenic
911410358 1:97497107-97497129 AAGCAGGGCAGAAGTGAGCAGGG + Intronic
911448578 1:98034125-98034147 AAAGAGAAGAGAAGAAAGGAAGG + Intergenic
911568356 1:99491962-99491984 CAGCTGATGAGAAGGGAGGAGGG - Intergenic
911697991 1:100915154-100915176 AAAAAGAAAAGAAGTGAGGAAGG - Intronic
911713925 1:101109129-101109151 TAGCAAAAGGGAAGGGAGGAAGG - Intergenic
911815639 1:102346292-102346314 AAGCAAAAAAGAGGTGATGATGG + Intergenic
912151201 1:106860773-106860795 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
912501405 1:110124724-110124746 AATCACAAAAGAAATGAGGAAGG - Intergenic
912791353 1:112654771-112654793 ATGCAGAGGAGAAGAGAGCATGG - Intronic
913058551 1:115183917-115183939 AAGTGGAAGTGAAGAGAGGAAGG - Intergenic
913288111 1:117246098-117246120 GAGGAGAGGAGAAGTGAGGCAGG - Intergenic
913491533 1:119384418-119384440 AAGCAGAAGAGAATTAGAGAGGG - Intronic
913527446 1:119707505-119707527 AAGCAGAAGAAAGGAAAGGAGGG - Intronic
913702474 1:121386090-121386112 AAGCAGGAGAGAAGTGGGTCAGG - Intronic
914043037 1:144066585-144066607 AAGCAGGAGAGAAGTGGGTCAGG - Intergenic
914135049 1:144893903-144893925 AAGCAGGAGAGAAGTGGGTCAGG + Intronic
914877001 1:151519430-151519452 AAGCTGATGAGAAGGGAGAAGGG - Intronic
914998023 1:152561744-152561766 AGGAAGAAGAGAAGGGATGAGGG - Intronic
915165924 1:153947754-153947776 AAGGGGAAGAGTGGTGAGGAGGG + Exonic
915172079 1:153985383-153985405 AGAAAGAAGAGAAGGGAGGAGGG + Intronic
915330492 1:155108822-155108844 AAGAAAGAGAGAAGGGAGGAAGG - Intergenic
915587707 1:156853068-156853090 AAGCAGTAGAGAAAGGAGAAAGG - Intronic
915605409 1:156947266-156947288 CAGCAGAAGAGGAGTCTGGAGGG + Intronic
915608485 1:156970844-156970866 AAGCTGATGAGAAGTGATGCTGG + Intronic
915987685 1:160482629-160482651 AAGGAGTAGAGATGTGAGTAGGG + Intergenic
916124003 1:161553163-161553185 ATCCAGGAGAGAAGTTAGGAAGG + Intergenic
916133886 1:161634525-161634547 ATCCAGGAGAGAAGTTAGGAAGG + Intronic
916400244 1:164439976-164439998 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
916474890 1:165159810-165159832 AAGGAAAAGTGAAGTCAGGAAGG + Intergenic
916853556 1:168727476-168727498 AACCAGTAGAGAGGTGATGATGG - Intronic
916881604 1:169024426-169024448 AAGGAGAAGAGGAGGAAGGAAGG + Intergenic
916889126 1:169099437-169099459 AAGCAGAAAACAGGGGAGGAGGG + Intergenic
917077867 1:171224519-171224541 AAGCAGAGGAGAACAAAGGAAGG - Intergenic
917253420 1:173088077-173088099 AAGAAGAAGGGATGTGGGGAGGG + Intergenic
917400371 1:174642665-174642687 AAGGAGAGGAGAGGAGAGGAGGG - Intronic
917503220 1:175604633-175604655 AAGGAGAGGAGGAGAGAGGATGG - Intronic
917682861 1:177385256-177385278 AAGAACAAGAGGAGTGGGGAGGG - Intergenic
917893166 1:179459807-179459829 AAGAAAAAGAGAAGGAAGGAAGG - Intronic
918107273 1:181425723-181425745 AAGCAGAAGAGAAGAGAAGGAGG - Intronic
918120086 1:181530706-181530728 CAGCAGAAGGGATGGGAGGAAGG - Intronic
918187775 1:182143170-182143192 AAGCAGCAGAGAACTGACAAAGG + Intergenic
918304423 1:183233108-183233130 ATGCAGAAGGGAGGTGAGGCAGG - Intronic
918389810 1:184047601-184047623 AATCACAAAAGAAGTGAAGATGG + Intergenic
918420200 1:184356596-184356618 AAGAAGAAAAGCAGTGAGAAAGG + Intergenic
918469923 1:184861560-184861582 AAGAAGGAGAGAAGGAAGGAAGG + Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918710116 1:187716749-187716771 AAGCATAGGACAAGAGAGGAAGG - Intergenic
918870303 1:189963940-189963962 AAGCACAAGAGTAGTGATGCTGG + Intergenic
918988856 1:191671152-191671174 AAGTAGAAGTGAAATGAGGTTGG + Intergenic
918995452 1:191753091-191753113 AGGCAAAAGAGAAGGAAGGAAGG - Intergenic
919098823 1:193068461-193068483 AAGAAGAGGAGAAGAGAGAAGGG + Intronic
919112955 1:193242419-193242441 AAGGAGAAGGGAAGCCAGGATGG - Intronic
919267292 1:195286263-195286285 AAGAAGGAGAAAAGGGAGGAAGG - Intergenic
919335508 1:196225564-196225586 CAGAAAAGGAGAAGTGAGGAGGG - Intergenic
919767799 1:201138539-201138561 GAGCAGAAGGGCAGTTAGGAGGG + Intronic
919882258 1:201908386-201908408 AAGAAAATGACAAGTGAGGATGG + Intronic
919923514 1:202180159-202180181 AAGCAGACGAGGGATGAGGAAGG + Intergenic
920073056 1:203316987-203317009 AGGCAGTAGATAAGTGAGGCTGG + Intergenic
920151834 1:203915899-203915921 AGGCAGGAGAGAAATAAGGAAGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920193423 1:204210366-204210388 AATGAGAAGAGAAGTGAGCTTGG - Intronic
920225449 1:204435258-204435280 AAGCAGGAGAGGAGTGGTGAGGG + Intronic
920288729 1:204901301-204901323 AAGCAGAAGAGAAGAGATCCTGG + Intronic
920489903 1:206404833-206404855 AAGCAGGAGAGAAGTGGGTCAGG - Intronic
920737235 1:208543863-208543885 AGAAAGAAGAGAAGGGAGGAAGG - Intergenic
920791553 1:209097642-209097664 AGGCAGAAGAGAAAAGAGGAAGG - Intergenic
920961097 1:210664768-210664790 TAGCAGAAGACAAGTCATGAGGG + Intronic
921210725 1:212894533-212894555 AAGCAGACAAGAGGAGAGGAAGG - Intronic
921304878 1:213786068-213786090 AAGAAGGAAGGAAGTGAGGATGG + Intergenic
921514828 1:216077063-216077085 AAACTGAAGAGCAGAGAGGAAGG - Intronic
921667718 1:217892806-217892828 AAGCACAAGAGTAGTGATGCTGG - Intergenic
921700454 1:218263368-218263390 AAGAAGAAGAGAAGAGAAGCTGG + Intergenic
922187931 1:223292955-223292977 ATGCTGAAGAGAGTTGAGGAGGG + Intronic
922916741 1:229264065-229264087 AGGCAGGAGAGAGGTGAGGCGGG + Intergenic
923029675 1:230237850-230237872 AAAAAAAAGAGAAGTGGGGAAGG + Intronic
923235782 1:232031447-232031469 AAGGAGAAGGGAAGGGAGAAGGG + Intronic
923366909 1:233270955-233270977 TATCAGAAGAGAAGAGAGAAAGG - Intronic
923397632 1:233582759-233582781 AAAGTGAAGAGAAGTGAAGATGG + Intergenic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923615297 1:235532402-235532424 AAGCACAAGAGTAGTGATGCTGG - Intergenic
923681295 1:236120926-236120948 AAAGGGAAGAGAAGTGGGGAGGG + Intergenic
923681787 1:236124381-236124403 CAACAGAAGAGTAGTCAGGAAGG - Intergenic
923751820 1:236753822-236753844 AAGGAGAAACGAAGGGAGGAGGG - Intronic
923844941 1:237719525-237719547 AGGAACAAGAGCAGTGAGGAGGG + Intronic
923852780 1:237815620-237815642 ATGAAGGAGAGCAGTGAGGAAGG + Intronic
923865778 1:237938108-237938130 GAGCAGAACACAAGTGAGGGAGG + Intergenic
923880688 1:238100892-238100914 AAGAAAAAGAGAAGAAAGGAGGG + Intergenic
924012827 1:239684795-239684817 AAGGAAAAGAAAAGAGAGGATGG + Intronic
924027313 1:239847929-239847951 AAAGAGAAGAGAAGAGAGGAGGG + Intronic
924188622 1:241523696-241523718 AATGAGAAGTGAAGTGAAGATGG - Intergenic
924365380 1:243287827-243287849 AAGGGGAAGTGAAGTGAGAAAGG + Intronic
1062852040 10:751580-751602 AAGCACAAGAGCAGTGATGGTGG - Intergenic
1062956734 10:1545436-1545458 AAGTAGAACAGAAATGAGAATGG + Intronic
1063071365 10:2669752-2669774 AAGAGGAAGAGAAGGAAGGAAGG + Intergenic
1063071376 10:2669822-2669844 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
1063532213 10:6844500-6844522 AAGCAGAAGGCCAGTGAAGAAGG + Intergenic
1064166787 10:12993602-12993624 CAGCAAGAGAGAAATGAGGAAGG + Intronic
1064674315 10:17746153-17746175 AAGTATAAGAGAAGTGGAGACGG - Intergenic
1064742468 10:18447953-18447975 AAGCAGAAAAGAAGGGATAATGG + Intronic
1064850124 10:19700684-19700706 AATCAGAAGAGAAGGTATGAAGG - Intronic
1065119851 10:22517573-22517595 AAGGAGAAGAGAAGAAAAGAAGG + Intergenic
1065348026 10:24767637-24767659 AAGGAAAAGAGAAGGGAGGGAGG - Intergenic
1065815930 10:29482493-29482515 AAATAGTAGAGAATTGAGGAGGG - Intronic
1065866425 10:29919079-29919101 AGGCAGAAGAGAGGGGAGGAGGG - Intergenic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1065998294 10:31080222-31080244 AAGGAAAAGAGACGGGAGGAAGG - Intergenic
1066641754 10:37560952-37560974 AAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1066701161 10:38130052-38130074 AAGTAGAATAGAAGTGACCAGGG - Intergenic
1067107404 10:43375321-43375343 AAGAAGAAAAAAAGTGAGGCTGG - Intronic
1067115347 10:43431606-43431628 AATCAAAAGAGAAGGAAGGAAGG - Intergenic
1067167559 10:43877866-43877888 AAGGAGTGGAGAAGAGAGGACGG - Intergenic
1067531519 10:47077584-47077606 CAGCAGCTGAGAGGTGAGGAAGG - Intergenic
1068335246 10:55626998-55627020 AAGAAGGAAAGAAGTCAGGATGG + Intronic
1068402021 10:56540306-56540328 AAGCACAAGAGTAGTGATGCTGG - Intergenic
1068485683 10:57655482-57655504 AGTCAGAAAAGATGTGAGGATGG + Intergenic
1068522154 10:58088937-58088959 GAGGAGAAGAGAAGAAAGGAAGG + Intergenic
1068799171 10:61120086-61120108 AGGAAGGAAAGAAGTGAGGAGGG + Intergenic
1068803751 10:61171660-61171682 AAACTGAAGAAAAATGAGGAGGG + Intergenic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1068841936 10:61625232-61625254 AAGTACAAGTGAAGTGAGCAAGG + Intergenic
1068948601 10:62755101-62755123 AAGCAGGAGAGAAGGAAGGAGGG + Intergenic
1069021719 10:63495767-63495789 AAGAAGAAGAAAATTGAGAAAGG + Intergenic
1069169835 10:65212851-65212873 AAGAAAGAGAGAAGTAAGGAGGG + Intergenic
1069184536 10:65406818-65406840 AAGCAAGAGAGAAGGGAGGGAGG - Intergenic
1069197772 10:65574164-65574186 AAGCAAAAGGGATGTGAGAAAGG + Intergenic
1069213635 10:65792473-65792495 AAGCAGAGGAGAACAAAGGAAGG + Intergenic
1069230280 10:66000307-66000329 AATCAAAAGAGAAAGGAGGAAGG - Intronic
1069313440 10:67068163-67068185 AAATAGAAGAGAAGGGGGGAAGG + Intronic
1069327853 10:67253096-67253118 AAGCACAAGAGTAGTGATGCTGG - Intronic
1069449214 10:68502737-68502759 AAGGAGAGGAGAGGAGAGGAGGG + Intronic
1069582135 10:69573335-69573357 AAGGAGAAAAGAAGAGAGAATGG + Intergenic
1069758001 10:70785533-70785555 AGGCAGCAGGGAAGTCAGGAGGG - Intergenic
1070010207 10:72466086-72466108 AAGCACAAGAGTAGTGATGCTGG - Intronic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070168686 10:73916341-73916363 GAGCCCTAGAGAAGTGAGGAGGG - Intronic
1070211075 10:74322794-74322816 AAGGGAAAGAGATGTGAGGAAGG - Intronic
1070415195 10:76182739-76182761 AAGCAGTAAAGAACTGTGGAAGG + Intronic
1070426873 10:76297444-76297466 AAGCAGAAGAGAACTAAGATGGG + Intronic
1070459079 10:76646688-76646710 AAACAGAAGTGAAGGAAGGAAGG + Intergenic
1071129902 10:82378535-82378557 GAGTAGAAGAGAAGAGAGGGAGG - Intronic
1071160496 10:82740196-82740218 AAGAAGAAAGGAAGAGAGGAAGG - Intronic
1071806109 10:89122960-89122982 AGTCAGAAGAGAAGTCAGGATGG - Intergenic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1071896113 10:90068550-90068572 AAGAAGAAAAGAAGGAAGGAAGG - Intergenic
1072193196 10:93092909-93092931 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1072275274 10:93816681-93816703 AAGGAGAAAAGAAGAGAGGCAGG + Intergenic
1072296441 10:94013299-94013321 TAGGAGGAGTGAAGTGAGGAGGG + Intronic
1072317429 10:94216305-94216327 AAGCAGATCAGAGCTGAGGAGGG + Intronic
1072454952 10:95567578-95567600 AAGAAGAAAAGAAGGAAGGAAGG + Intergenic
1072511419 10:96129963-96129985 AAGCGGAAGAGAACGGAGGCCGG - Exonic
1072817991 10:98528467-98528489 AAGCAGGAGAGCAAAGAGGATGG + Intronic
1072839982 10:98762009-98762031 AAGGAGAGGAGAAGAGGGGAGGG - Intronic
1072866034 10:99062751-99062773 TGGCAGAGGAGAGGTGAGGAAGG + Intronic
1072866297 10:99065909-99065931 AAGCTGAAGAGAGGTGAAGAAGG - Intronic
1072926958 10:99624129-99624151 AAGAAAAAGAGAAGACAGGAAGG - Intergenic
1072974801 10:100048272-100048294 AAGCCAAAAGGAAGTGAGGAAGG + Intronic
1073565793 10:104534683-104534705 AAGAGGAAGGGAAGGGAGGAGGG - Intergenic
1073731358 10:106292016-106292038 AAGGAGAAGAGAGGGAAGGAAGG + Intergenic
1073836110 10:107444742-107444764 GAGCAAGAGAGAGGTGAGGAAGG - Intergenic
1073954946 10:108859546-108859568 AAAGAGAAGAGAAGAGAAGATGG + Intergenic
1073983453 10:109181203-109181225 AGGCAGAAGACAAGAGTGGAAGG + Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074148162 10:110735119-110735141 AAGCATAAGAGTAGTGATGCTGG + Intronic
1074262228 10:111865570-111865592 AAGCAGAGGAGGAGTGAGGTTGG + Intergenic
1074403938 10:113164820-113164842 AATCAGGTGAGAAGGGAGGAAGG - Intronic
1074522862 10:114240375-114240397 AGACAGAAGAGAAGGGAGGAGGG + Intronic
1074617780 10:115087439-115087461 AAACAGAAGAGAATTGTGCAGGG - Intergenic
1075100669 10:119503974-119503996 GAGCAAAAGAGAAGGGCGGAAGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075266320 10:121002099-121002121 AAGGAGAACAGAAGGGAGGGAGG - Intergenic
1075354719 10:121761078-121761100 AAGCAAGAGAGAGGAGAGGAAGG - Intronic
1075440232 10:122474430-122474452 AGGCAGAAGAGACGTGAGGGAGG - Intronic
1075497618 10:122939322-122939344 AAAGAGAAAAGAAGTGAAGAAGG + Intronic
1075554313 10:123419161-123419183 GAGGAGAAGAGAAGAGAGGAGGG - Intergenic
1075619452 10:123915070-123915092 AGGCGGGGGAGAAGTGAGGAAGG - Intronic
1075667111 10:124239485-124239507 AAAAAGAAGAGAAGGAAGGAAGG + Intergenic
1075667745 10:124243105-124243127 ACCCAGAAGAGCAGTGAGGCGGG + Intergenic
1075844665 10:125535632-125535654 AGGAAGAAGAAAAGGGAGGAAGG - Intergenic
1075929147 10:126279744-126279766 AAGAAGAAGACAAGAGTGGAGGG + Intronic
1076028168 10:127134459-127134481 CAGCAGAAGATAAATGGGGAGGG - Intronic
1076289228 10:129331612-129331634 AATGAGAGGAGAAGGGAGGAAGG + Intergenic
1076295325 10:129379279-129379301 CAGCAGAAGAGTAGAGAGGTGGG - Intergenic
1076359387 10:129876375-129876397 AAGCAGAATGGAAGTCAGGCAGG - Intronic
1076571955 10:131438901-131438923 AGGGAGAAGGGAAGAGAGGAGGG - Intergenic
1077002617 11:331953-331975 AACCACAAGAGAAGTGAAAATGG + Intergenic
1077606446 11:3615992-3616014 GAAGAGAAGAGCAGTGAGGATGG + Intergenic
1077881392 11:6353540-6353562 AAGCAGGTGAGAAGTGAGAGAGG - Intergenic
1078163058 11:8858533-8858555 AGACAGAAGAGATGGGAGGAAGG + Intronic
1078393051 11:10953088-10953110 AGTCTGAAAAGAAGTGAGGATGG + Intergenic
1078469511 11:11575764-11575786 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
1078922813 11:15846066-15846088 AAGAAGAATGGAATTGAGGAGGG - Intergenic
1079050607 11:17154704-17154726 CAGAGGAAGAAAAGTGAGGAAGG + Intronic
1079170763 11:18093212-18093234 AAGCACAAGAGTAGTGATGCTGG + Intronic
1079189282 11:18264690-18264712 GAGGAGAGGAGAAGAGAGGAGGG + Intergenic
1079778992 11:24574365-24574387 AAGAAGAAAAGAAGGAAGGAAGG - Intronic
1079817178 11:25076482-25076504 AAGAAGAAAGGAAGAGAGGAAGG + Intronic
1079850171 11:25523015-25523037 AAGCAAAAGAGAGGAGAGGGAGG - Intergenic
1079913631 11:26341085-26341107 AAGGGGAAGAGAAGCGGGGAGGG - Intronic
1080115545 11:28617885-28617907 TGGCACAAGAGATGTGAGGAAGG + Intergenic
1080115945 11:28621754-28621776 AACAAGAAGAGAAGGGAGGTGGG - Intergenic
1080279251 11:30537669-30537691 AAGGAGGAGAGTAGGGAGGAAGG + Intronic
1080301137 11:30786053-30786075 AAAACGAAAAGAAGTGAGGATGG + Intergenic
1080303812 11:30815196-30815218 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1080499367 11:32853857-32853879 AAGAAGAAGAAAAGAGAAGAAGG + Exonic
1080693266 11:34577775-34577797 AAGCAGATGAAAAGTAAAGAAGG + Intergenic
1080844714 11:36016387-36016409 AAGCACAAGAGAAGTAAGTTTGG - Intronic
1080913913 11:36635531-36635553 AATCACAAGAGATGTGAGCAGGG - Intronic
1081557345 11:44177458-44177480 AAACAGAAGTAAAATGAGGAGGG - Intronic
1081821732 11:46003657-46003679 ATGTAGAAGAGAAGTAAAGATGG + Intronic
1082105611 11:48218096-48218118 AGAAAGAAAAGAAGTGAGGAAGG - Intergenic
1082132443 11:48506540-48506562 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1082565871 11:54677089-54677111 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1083129432 11:60610632-60610654 AAACAAAAAAGAAGGGAGGATGG + Intergenic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083391492 11:62354498-62354520 AAGCACAAGAGTAGTGATGCTGG - Intronic
1083486475 11:62985788-62985810 GAGGAGAAGAGAAGAGAAGAGGG - Intergenic
1084021776 11:66422055-66422077 AGGCAGAGAAGAAGTGAGGAAGG - Intronic
1084104268 11:66970802-66970824 AGGCAGAGAAGCAGTGAGGAGGG + Intergenic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084441848 11:69179099-69179121 GGGCAGAAGAGAAGGAAGGAGGG + Intergenic
1084712999 11:70855714-70855736 AAGATGAACAGAAGAGAGGAAGG + Intronic
1084991362 11:72928481-72928503 AAGTGGAAGAGAAGGGGGGAAGG - Intronic
1085026898 11:73241672-73241694 ACCCAGAAGAGGAGTGATGAAGG - Intergenic
1085322575 11:75583803-75583825 AAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1085331989 11:75660108-75660130 AAGGAGGAGTGATGTGAGGAGGG - Intronic
1085502648 11:77037953-77037975 AAGAAGAAGAGGAGGGGGGAAGG + Intronic
1085753961 11:79188647-79188669 AAGCAGAAGAGAAGTGAGGATGG + Intronic
1085753980 11:79188718-79188740 GAGCAGTAGAAAAGGGAGGAGGG + Intronic
1085918465 11:80921629-80921651 AGGCAGAAGAGAACAAAGGAAGG - Intergenic
1086177096 11:83904020-83904042 AAGCACAAGAGTAGTGATGTGGG - Intronic
1086336850 11:85809770-85809792 AAGGAGAAGAGGTGTGGGGACGG - Intronic
1086365028 11:86100448-86100470 AGGAAGAATAGAAGGGAGGAAGG - Intergenic
1086722416 11:90137200-90137222 AACTAGAAGGGTAGTGAGGAGGG + Intronic
1087065740 11:94026461-94026483 AAACAGGAGAGAACTGAGGTAGG - Intronic
1087314856 11:96591214-96591236 AAGCAAAAGCGAAGAGAGGCTGG - Intergenic
1087324885 11:96709679-96709701 AAGAAGAAAAGAAAGGAGGAAGG - Intergenic
1087448855 11:98291949-98291971 AAGCAGGAGAGAAGACAGAATGG - Intergenic
1088187766 11:107192580-107192602 AAGAAGCAGAGAAAAGAGGATGG - Intergenic
1088243809 11:107797339-107797361 AAGAAGATGAGAAGGAAGGAGGG + Intronic
1088443684 11:109900790-109900812 AAGGAAAAGAGAGGAGAGGAGGG + Intergenic
1088622024 11:111694811-111694833 AAGGGGAAGAGAAATGAAGAGGG - Intronic
1088686967 11:112292259-112292281 AAGGGGAAGAGAAGGGAGGGAGG - Intergenic
1088738138 11:112745536-112745558 AAGCAGAAGAGATAAGAGGCAGG + Intergenic
1088934484 11:114385312-114385334 AAACAGAAGAAAAGAGAGCATGG + Intergenic
1089095544 11:115917184-115917206 AAACAGAAAGGAAGGGAGGATGG - Intergenic
1089225559 11:116917787-116917809 AAGGAGAGGACAAGAGAGGAAGG + Intronic
1089342495 11:117767961-117767983 AGGCAGAAGAGGAGTGAGAGGGG - Intronic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089591089 11:119541018-119541040 AAGAAGGAGAGAAATGGGGAAGG + Intergenic
1089612535 11:119677485-119677507 AAGGAGAGGAGGAGGGAGGAGGG + Intronic
1089646633 11:119884687-119884709 AAGCAGAATGAAAGTGAGGGCGG - Intergenic
1089748507 11:120633800-120633822 AGGCAGAAGGGAAGTGTGGCTGG + Intronic
1089863784 11:121614107-121614129 AAGAAAAAGAAAAGTGAGAAGGG - Intronic
1090000796 11:122955803-122955825 ATCCAGAAGAGAAGTGAAGAAGG - Intronic
1090003831 11:122983424-122983446 AAGGAGAAGGGAAGGGAAGAAGG + Intergenic
1090306921 11:125699181-125699203 AGCCTGGAGAGAAGTGAGGAGGG - Intergenic
1090311978 11:125749064-125749086 AAGCAGCAGAGGAAAGAGGAAGG - Exonic
1090494934 11:127202169-127202191 AGGTAGAATAGAAGTGAGGTGGG - Intergenic
1090560214 11:127924391-127924413 GAGCATTAGGGAAGTGAGGAAGG + Intergenic
1090636020 11:128691025-128691047 AGGAAGGAGAGAAGAGAGGAGGG + Intronic
1090726004 11:129527841-129527863 AAGCACAAGAGTAGTGATGCTGG - Intergenic
1090818851 11:130322510-130322532 AAGCAGAGGAGAACAAAGGAAGG + Intergenic
1090863285 11:130673256-130673278 CAGCAGAAGAGAAATGATGGTGG + Intronic
1090887443 11:130891634-130891656 AAGAAGAAAAGAAGAGAGGAAGG + Intronic
1091038141 11:132252278-132252300 AAACAAATGAGAAGTTAGGATGG - Intronic
1091524999 12:1290932-1290954 ATGCAGAGAAGAAGTGAGCAAGG - Intronic
1091658220 12:2361482-2361504 AAGGAGAAATGAAGGGAGGAAGG - Intronic
1091800712 12:3323027-3323049 AAGGAGAAGGGAAGGGAGAAGGG + Intergenic
1091818896 12:3459689-3459711 AAGCAGAGGAGCAGGGAGAAGGG + Intronic
1091885977 12:4017337-4017359 TAGCAGAAGAAAAGAGAGGTGGG - Intergenic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092195279 12:6545887-6545909 AAGCACAAGAGTAGTGATGCTGG + Intronic
1092315735 12:7411544-7411566 AAGCAAGAGAGAAGGGAGCAAGG - Intronic
1092449983 12:8593233-8593255 AAGGAGAGGAGAGGAGAGGATGG + Intergenic
1092552253 12:9515435-9515457 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1092850277 12:12619851-12619873 AGGTAGAAAAGAAGTGTGGAGGG - Intronic
1093171034 12:15860869-15860891 GAGCAGAAGTGAAGTGTGCAAGG + Intronic
1093179873 12:15954629-15954651 AGGCAGAGGAGCAGTGAGGGAGG + Intronic
1093523338 12:20076078-20076100 AGGAAGGAGAGAAGGGAGGAAGG - Intergenic
1094001042 12:25694389-25694411 AAGCACAAGAGTAGTGACGCTGG + Intergenic
1094519866 12:31175176-31175198 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1095148392 12:38759865-38759887 CAGCAGAAGGGAAGAGAAGAGGG + Intronic
1095301932 12:40594648-40594670 GAGTAGAAGAGTAGGGAGGAGGG - Intergenic
1095316047 12:40763066-40763088 GAGAGGAAGAGAAGTGAAGATGG - Intronic
1095624092 12:44294634-44294656 AAGCACAAGAGTAGTGATGCTGG - Intronic
1095636910 12:44445783-44445805 AGTCAGAAGAGAGGTGAGGTAGG + Intergenic
1095727522 12:45469571-45469593 AAGCAGAGCAGAACAGAGGATGG + Intergenic
1095999398 12:48116197-48116219 AAGGAGAAAAGAAGGAAGGAGGG - Intronic
1096086106 12:48866008-48866030 AAGAGAAAGAGAAGGGAGGAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096603084 12:52744302-52744324 AAAGAGAAGGGAAGGGAGGAAGG + Intergenic
1096784329 12:54008633-54008655 AAGGAAAAGAGAAGCGAGGCTGG + Intronic
1096914589 12:55017678-55017700 AAGCAGCAGAGAAAGAAGGAAGG + Intergenic
1096972741 12:55681075-55681097 AAGAAGGAAAGAAGGGAGGAAGG + Intergenic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1097901904 12:64881783-64881805 AAGCAGCAGAGAGGTGGGGTGGG - Intergenic
1098044347 12:66384669-66384691 AGTAAGAAGATAAGTGAGGAAGG + Intronic
1098058831 12:66538546-66538568 AAGCAGAAGAGTAGTGAGATTGG + Intronic
1098610358 12:72449892-72449914 TAGAAGGAGAAAAGTGAGGAAGG - Intronic
1098625263 12:72658407-72658429 AAACAGGAGAGAAGAGAAGAGGG - Intronic
1098652853 12:72995610-72995632 AAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1098959325 12:76722438-76722460 AAGAAGAAAAGAAGGAAGGAAGG + Intergenic
1098990786 12:77063210-77063232 AAGCACAAGAGTAGTGATGCTGG + Intronic
1099096015 12:78375676-78375698 AGGCAGATGAGAAGTGATGCTGG - Intergenic
1099097193 12:78389492-78389514 TAGCAGAAGATAAGTAAGGCTGG + Intergenic
1099101787 12:78450556-78450578 AAAAAGAAGAGGAGAGAGGAAGG + Intergenic
1099150122 12:79100455-79100477 AAGGAGGAGAGAGGAGAGGAAGG + Intronic
1099265357 12:80439490-80439512 AAACAGAAGAGCAGTGATGATGG + Intronic
1099816976 12:87661859-87661881 AAGCATAAGAGTAGTGAAGCTGG - Intergenic
1099907855 12:88793080-88793102 AAGGAGAAAAGAACGGAGGAAGG - Intergenic
1100129693 12:91476085-91476107 AAAAAGAAAAGAAGAGAGGATGG + Intergenic
1100330937 12:93581679-93581701 AAGCAGGTGAGAAGGGAGGGAGG - Intronic
1100375554 12:94013174-94013196 AAGAAGAAGAGAAGAGGAGAGGG + Intergenic
1100697277 12:97108976-97108998 AAGTAGTAGTGCAGTGAGGATGG - Intergenic
1100872135 12:98921154-98921176 AAGAAGAAAAGAAAGGAGGAAGG - Intronic
1101156706 12:101934586-101934608 AAGCAGAATAGAAGTTACTAGGG + Intronic
1101234957 12:102779088-102779110 AAGCAGAAAAGAAATGGGGCAGG + Intergenic
1101348362 12:103905885-103905907 AAGCAGGAAGGAAGGGAGGAAGG + Intergenic
1101418664 12:104531067-104531089 AAGGAGAAGGGAAGAGATGAAGG - Intronic
1101500076 12:105295592-105295614 AAGCAGAGAAGAAATGATGAGGG - Intronic
1101510252 12:105386531-105386553 AAGAAAAAGAGAAGGAAGGAAGG - Intronic
1102194729 12:111016928-111016950 GAGAAGAAGAGAAGGGAGGGAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102378906 12:112446555-112446577 TAGCAGAAGAGGAGTAAGGAGGG + Intronic
1102513312 12:113430021-113430043 AAGGAGAAAAGAAGGAAGGAAGG - Intronic
1102517505 12:113459784-113459806 AAGAGGAAGAGAAGGGAGAAAGG - Intergenic
1102520865 12:113476879-113476901 AAGGAGGAGAGAAGAGAGGGAGG - Intergenic
1102623143 12:114212911-114212933 AAGCAGAATTGGAGAGAGGAAGG + Intergenic
1102652454 12:114451835-114451857 AGGGAGAAAAGAAGGGAGGAAGG - Intergenic
1102753437 12:115316703-115316725 AAGAAGAAAAGAAGGGAAGAAGG + Intergenic
1103162859 12:118744557-118744579 AAGAAGAGGAGCAGTGGGGAGGG + Intergenic
1103185047 12:118949462-118949484 CAACAAAAGAGAAGTGGGGAAGG - Intergenic
1103597807 12:122034835-122034857 AAGCGCAAGAGGAGTTAGGAAGG - Intronic
1103610047 12:122118019-122118041 AAGCATAAGAGTAGTGATGCTGG - Intronic
1103700025 12:122844431-122844453 AAGCAGGACAGAAGTGATAATGG - Intronic
1103762362 12:123260303-123260325 AGGCAGAAGAGAACAAAGGAAGG - Intergenic
1103831680 12:123784756-123784778 AAGCAGAACAGAAGTTACCAGGG - Intronic
1103954528 12:124568712-124568734 AAGCAGAAGAGGAGGGAGGGAGG - Intergenic
1103976674 12:124707234-124707256 AAACAGAAAAGGAGGGAGGAAGG + Intergenic
1104264030 12:127213532-127213554 AATCAGGAGAGAGGTCAGGAAGG - Intergenic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104316209 12:127704316-127704338 AAGAAGAAGAGGAGGAAGGAGGG + Intergenic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1104640673 12:130464960-130464982 AATCAGAAAAGAAGTGAAAAAGG + Intronic
1104806961 12:131595735-131595757 AGGCTGCTGAGAAGTGAGGATGG + Intergenic
1105250154 13:18691664-18691686 AAGGAAAAGAGAAGGAAGGAAGG + Intergenic
1105284446 13:18993116-18993138 AAGCAGAAGGAAAGGAAGGAAGG + Intergenic
1105972028 13:25438143-25438165 GGGCAGATGAGAAATGAGGAAGG + Intronic
1106125026 13:26894226-26894248 AAGAAGAAAGGAAGGGAGGAGGG + Intergenic
1106132771 13:26953250-26953272 AAGGAGAAGGGAAGGGAGGGGGG + Intergenic
1106594329 13:31123732-31123754 AGGAAGAAAAGAAGGGAGGAGGG - Intergenic
1107094246 13:36517577-36517599 AAGCATAAGAGTAGTGATGCTGG + Intergenic
1107095075 13:36527281-36527303 AAGCAGCAGAGGAGGGAGAAGGG + Intergenic
1107125442 13:36840743-36840765 AAGAACAAGAGATGTGATGATGG + Intergenic
1107364069 13:39651287-39651309 AAGCAGGAGAGAAAAGAAGAAGG - Intergenic
1107399188 13:40052182-40052204 AGGCTGAAGAGCAGAGAGGAAGG + Intergenic
1107592631 13:41924374-41924396 AAACAGGAGAGAAGAGAGGAGGG + Intronic
1107611595 13:42118802-42118824 AGGCAGAAGAGAACTAATGAAGG + Intronic
1107655509 13:42588960-42588982 ATGCAGAAGCTAAGTGAGAATGG - Intronic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107732746 13:43365105-43365127 AAAGAGAGAAGAAGTGAGGAAGG - Intronic
1107767396 13:43751308-43751330 AACCAGAAGAGCAGTGATGCAGG - Intronic
1108096503 13:46907374-46907396 AAGAAGAGGAGAAGAGGGGAGGG - Intergenic
1108266105 13:48710469-48710491 AAGCATAAGAGTAGTGATGCTGG + Exonic
1108462148 13:50677335-50677357 AAGCAGAAGCGAAGATGGGAAGG + Intronic
1108722358 13:53145347-53145369 GAGGAGAGGAGAAGGGAGGAGGG - Intergenic
1108826522 13:54418612-54418634 AAGTATTAGAGAGGTGAGGAAGG - Intergenic
1108832263 13:54494840-54494862 AATCACAAGAGAAGTGAAAATGG + Intergenic
1109320809 13:60807583-60807605 AAGCAGAAGTGATGTGAAAATGG - Intergenic
1109350521 13:61174586-61174608 AGGGCTAAGAGAAGTGAGGAAGG + Intergenic
1109822715 13:67679561-67679583 AAGCAGAAAAGGACTGGGGAGGG - Intergenic
1109997615 13:70149929-70149951 AGGCAGAGAGGAAGTGAGGAAGG + Intergenic
1110029074 13:70582618-70582640 AAGAAGGAAAGAAGAGAGGAAGG - Intergenic
1110097393 13:71545509-71545531 AAGAAGAAAAGAAGAAAGGAAGG + Intronic
1110136841 13:72078067-72078089 AAGCTTAAGAGAATTGATGAAGG + Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110786321 13:79531682-79531704 AAGACTGAGAGAAGTGAGGAAGG - Intronic
1110879357 13:80552453-80552475 AAGAAGGAGAGAAGGAAGGAGGG + Intergenic
1111006332 13:82254790-82254812 AGGAAGGAGAGAAGGGAGGAAGG + Intergenic
1111093440 13:83477396-83477418 AAGGAGAAGAGAAGGGAGAGAGG + Intergenic
1111528471 13:89505537-89505559 ATGCAAATGAGAAGTTAGGAAGG + Intergenic
1111711700 13:91823592-91823614 AAGTAAAAGAGATGTGAAGAAGG - Intronic
1112038185 13:95517135-95517157 AAGAAGGAAAGAAGGGAGGAAGG - Intronic
1112119520 13:96394431-96394453 ATGCAGGACAGGAGTGAGGATGG - Intronic
1112130099 13:96514062-96514084 AAGCAGTAGGGATGTGAGTAGGG + Intronic
1112498870 13:99926864-99926886 AAGCAGAAGAGGAGCCAGGCAGG + Intergenic
1112811658 13:103225444-103225466 AAGCAGAAGAGTAGTGATGCTGG - Intergenic
1113110183 13:106814323-106814345 AGGAAGAAGGGAAGGGAGGAAGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113575378 13:111391606-111391628 AAGCACAAGGGCAGTGAGGCTGG - Intergenic
1113648205 13:112013746-112013768 AAGCACAAGAGCAGTGAGGCTGG - Intergenic
1113678749 13:112227132-112227154 GAGGAGGAGAGGAGTGAGGAGGG - Intergenic
1113748275 13:112761212-112761234 AAGCACAAGAGCAGTGAGGCAGG + Intronic
1113749100 13:112766312-112766334 AAGCAGAAGAGGGATGAGTAAGG + Intronic
1114040408 14:18673121-18673143 GAAGAGAAGAGAAGAGAGGAGGG + Intergenic
1114045445 14:18871632-18871654 GAAAAGAAGAGAAGAGAGGAGGG + Intergenic
1114118767 14:19647836-19647858 GAAAAGAAGAGAAGAGAGGAGGG - Intergenic
1114231336 14:20785687-20785709 AAGGAGTAGAGACGTGAGGGAGG + Intergenic
1114524160 14:23357711-23357733 AAGGAGAAAAGAAGTGAGGGAGG - Intronic
1114726098 14:24939291-24939313 AACTAGAATAGAAGTCAGGAAGG - Intronic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1114850264 14:26374700-26374722 GAGCGAAAGAGAAGGGAGGAAGG - Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115233836 14:31189311-31189333 ATACAAAAAAGAAGTGAGGAGGG - Intronic
1115497825 14:34024544-34024566 GAGGAGAAGAGAAGGGAGAAGGG - Intronic
1115507759 14:34109224-34109246 TAGCAGAAGAGAGGGAAGGAGGG + Intronic
1115837948 14:37431413-37431435 AATCTTAAGAGAAGTAAGGATGG - Intronic
1115933636 14:38527176-38527198 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
1116105536 14:40498337-40498359 AAGCATAAGAGTAGTGATGCTGG + Intergenic
1116470723 14:45282551-45282573 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
1116647061 14:47541637-47541659 AATCAGAAAAAAAGTGGGGAGGG + Intronic
1116863582 14:50013763-50013785 AAGAAGAAAAGAAATGACGAAGG + Intergenic
1117058833 14:51940166-51940188 AAAAAGAAGAGGAGTGGGGACGG + Intronic
1117490495 14:56241943-56241965 AAGAGGAAGACAAGTGATGAAGG + Intronic
1117540586 14:56743018-56743040 AAACAGCTGAGAAGTGAAGAGGG + Intergenic
1117622748 14:57604156-57604178 ATACAGAAGAGAAGTGATGTTGG - Intronic
1117914007 14:60658173-60658195 AGGCAGAAGATAAGTGAGTCTGG - Intronic
1117953861 14:61107900-61107922 GAGCAGAGGAAAAGTGAGGCCGG + Intergenic
1118304946 14:64647994-64648016 AAGCAGAAGAGGAGGTAGGCCGG + Intergenic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1119617644 14:76109411-76109433 AGTCTGAAGAGAAGTGAGGCTGG - Intergenic
1119625931 14:76175381-76175403 AAGCAGAAGAGAGATGGGGGAGG - Intronic
1119707332 14:76791270-76791292 AAACAGAAGAGAACTGGAGAAGG + Intronic
1120598041 14:86465387-86465409 AAGCAAGAGAGAAGGAAGGAAGG + Intergenic
1120800431 14:88682551-88682573 AACCAGATGAGGAGGGAGGAAGG - Intronic
1120828660 14:88978421-88978443 AAGAAGAACTGAAGTGAAGAGGG + Intergenic
1120860061 14:89246987-89247009 AAGAGGGAGAGAAGGGAGGAAGG - Intronic
1120904149 14:89605038-89605060 AAACCTAAGAGAAGTGATGAAGG + Intronic
1121090326 14:91176929-91176951 AAGAAGAAGGGAAGGAAGGAAGG - Intronic
1121108397 14:91295716-91295738 CAGCATAAGCGAAGTGATGAGGG - Intronic
1121186163 14:91971617-91971639 AAGGGGAAGGGAAGAGAGGAAGG + Intronic
1121219015 14:92271904-92271926 AAGCAAAAGAGAAGAGACGGAGG - Intergenic
1121578745 14:95010486-95010508 AGGAAGAAGGGAAGGGAGGAAGG + Intergenic
1121588242 14:95078766-95078788 AACCAGCAGAGTAGAGAGGATGG - Intergenic
1121600153 14:95197355-95197377 AAGAAGGAGAGAAGGAAGGAAGG + Intronic
1122089222 14:99327183-99327205 GAGCAAGAGAGAAGTGGGGATGG + Intergenic
1122096427 14:99376412-99376434 AGGCAGAAAAGAAGGAAGGAAGG + Intergenic
1122253925 14:100463031-100463053 AAGAAGAAGAGAAGGGAAAAAGG - Intronic
1122376224 14:101260873-101260895 AAGCACAAGAGTAGTGATGCTGG + Intergenic
1122392521 14:101399931-101399953 GGGCAGAAGAGAAGAAAGGAAGG + Intergenic
1122417307 14:101556603-101556625 ATGCAGACGAGACCTGAGGAAGG + Intergenic
1122682545 14:103476970-103476992 AAGGGGAAGAGAAGTCATGAAGG - Intronic
1123093630 14:105753736-105753758 AGGCAGAAGAGAAGGAAGGAAGG - Intergenic
1123432450 15:20230080-20230102 GAGGAGAAGAGAAGGGAAGAGGG + Intergenic
1123838048 15:24216333-24216355 AGGCAGAAGAGAACAAAGGAAGG - Intergenic
1123957191 15:25349751-25349773 AAGCACAAGAGCAGTGATGTTGG - Intronic
1124117073 15:26854648-26854670 AAGCAAGAGAGAAGAGAGGGAGG - Intronic
1124609474 15:31198449-31198471 AAGCAGAGGAGAAGGGATGCTGG - Intergenic
1124643390 15:31415071-31415093 AAGCAACAGAGAGGGGAGGAAGG - Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125049741 15:35283120-35283142 AAGAAGAAGAGAAGAGGAGAAGG - Intronic
1125368329 15:38942924-38942946 AGGGAGAAGAGCAGGGAGGAAGG + Intergenic
1125766899 15:42142218-42142240 AAGCAGAGGAGAGGCCAGGATGG + Intronic
1125812140 15:42550650-42550672 ACACAGGAGAGAAGGGAGGAAGG - Intronic
1126020227 15:44392984-44393006 AAGCGGAATAGAAGTGATGATGG - Intronic
1126131738 15:45348467-45348489 AGGCTGGAGTGAAGTGAGGAAGG + Intergenic
1126193059 15:45899244-45899266 AAGCACAAGAGTAGTGATGCTGG + Intergenic
1126193443 15:45903541-45903563 AAGGAGAAGAGGAGAAAGGAAGG - Intergenic
1126258189 15:46653176-46653198 AAGCAGAAAGGAAGGAAGGAAGG + Intergenic
1126359839 15:47835064-47835086 AAGCAGTGGAGCAGTGAGGCAGG - Intergenic
1127118419 15:55749854-55749876 CAGGAAAAGAGAAGTGATGAAGG + Intergenic
1127385160 15:58461052-58461074 ACCCAGAAGTGAGGTGAGGACGG + Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127965775 15:63921811-63921833 AAGCAGGAGAGAAGGAAGGAAGG - Intronic
1128185209 15:65638827-65638849 AGGAAGAAGAGAAGGGAGGGAGG + Intronic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128490810 15:68141344-68141366 AAACAGAAGAGAATTAAGAAAGG - Intronic
1128617481 15:69121547-69121569 AAGGAGAAGAGAAGTAAAGAAGG - Intergenic
1128908071 15:71486213-71486235 AGGCAGAAGAGGATCGAGGAAGG - Intronic
1129165244 15:73773574-73773596 AGGCAGAAAAGGAGGGAGGAGGG - Intergenic
1129199312 15:73989328-73989350 GAGGAGGAGAGAAGTGAGGAAGG - Intronic
1129547550 15:76413263-76413285 ATGCTGAATAGAAGTGATGAGGG + Intronic
1130052258 15:80493606-80493628 AAGCAGAAGACAAGTGACCTAGG - Intronic
1130856550 15:87844164-87844186 AGGCAGAAGAGGTGGGAGGAAGG - Intergenic
1130879116 15:88039907-88039929 AAGCAGAGGAGAACCAAGGAAGG + Intronic
1130928679 15:88404512-88404534 CAGCAGAAGAAAAGTGAATATGG + Intergenic
1130982734 15:88823858-88823880 TAGCAGAAAAGGAGTGAGAATGG + Intronic
1131033238 15:89203959-89203981 ACCCAAGAGAGAAGTGAGGAGGG - Intergenic
1131161382 15:90107141-90107163 TAGCAGACGAGAAGAGAGGGAGG - Intergenic
1131769228 15:95716832-95716854 AAGCAAAAGAGAAAGAAGGAAGG + Intergenic
1131780064 15:95846328-95846350 AGGGAGAAGGGAAGAGAGGAGGG + Intergenic
1132213299 15:100042598-100042620 AAGCACAAGAGTGGTGATGATGG - Intronic
1132425041 15:101709106-101709128 CAGCAGAGGAGAAATGAGGCAGG - Intronic
1132752516 16:1465343-1465365 AAGCAGAAGAGAAATCATGAGGG + Intronic
1132873848 16:2127248-2127270 AAGAACAAAAGGAGTGAGGACGG + Intronic
1133366816 16:5216754-5216776 GAGCAGAGAAGAAATGAGGAGGG - Intergenic
1133469244 16:6058293-6058315 AGGAAGAAGAGGAGGGAGGAAGG - Intronic
1133517280 16:6521529-6521551 AAGGAGAGGAGAGGAGAGGAAGG - Intronic
1133594001 16:7272998-7273020 AGGCAGAAAGGAAGGGAGGAAGG - Intronic
1133835724 16:9365813-9365835 AAGAAGACTAGAGGTGAGGATGG + Intergenic
1134234656 16:12455827-12455849 AAGCAGGAAAGAAGGAAGGAGGG - Intronic
1134291733 16:12907108-12907130 AAGAAGAAAGGAAGAGAGGAAGG - Intronic
1134291781 16:12907277-12907299 AAGAAGCAAAGAAGGGAGGAAGG - Intronic
1134291796 16:12907345-12907367 AAGAAGATGAGAAGAGGGGAGGG - Intronic
1135088155 16:19490998-19491020 AAGAAAGAGAGAAGTAAGGAAGG - Intronic
1135159633 16:20082409-20082431 AAGAAGGGGAGAAGAGAGGAGGG + Intergenic
1135524205 16:23201601-23201623 AATCAGAAAAGAAGAAAGGAAGG - Intronic
1135667399 16:24347368-24347390 AAGAGAAAGAGAAGGGAGGAAGG + Intronic
1135748301 16:25036291-25036313 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1136511227 16:30739255-30739277 AAGCAGAAGGAATGCGAGGACGG + Exonic
1136600966 16:31288099-31288121 AAGCACAAGAGAAGTGAAAAGGG + Intronic
1136938413 16:34498588-34498610 AAGCGGAAAAGAAGAAAGGAAGG - Intergenic
1136961406 16:34849969-34849991 AAGCGGAAAAGAAGAAAGGAAGG + Intergenic
1137218665 16:46426451-46426473 AAGCAGAAAAGAAGAAAGGAAGG - Intergenic
1137218705 16:46426662-46426684 AAACAAAATAGAAGGGAGGAAGG - Intergenic
1137289962 16:47045740-47045762 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1137457982 16:48632788-48632810 AAGCAGAAAAGAAGAAAGAAAGG - Intergenic
1137500706 16:49009928-49009950 GAGCAGAAGAGAAGCATGGAGGG + Intergenic
1137863686 16:51871795-51871817 AAGGAGAAGAGAAGGAAGGAGGG + Intergenic
1138002086 16:53291532-53291554 AAGCAATAGAGAAGTGTGAAAGG + Intronic
1138435197 16:56994760-56994782 AAGCAGAGAAGAGGAGAGGAGGG + Intronic
1138646270 16:58427337-58427359 AAGAAGAAGAGAGGGAAGGAAGG - Intergenic
1138717345 16:59038613-59038635 AAGCATCTTAGAAGTGAGGATGG - Intergenic
1139028986 16:62855895-62855917 AGGCAGAAAGGAAGGGAGGAAGG + Intergenic
1139085196 16:63576338-63576360 AAGCAGATGAGAAATTTGGAGGG + Intergenic
1139322653 16:66127888-66127910 AAGCGGAAGAAAAGGGAAGATGG + Intergenic
1139490437 16:67283163-67283185 AGGCAGAAGAGGGTTGAGGATGG + Intronic
1139561060 16:67742713-67742735 AAGCTGGAGGGATGTGAGGAAGG + Intronic
1139749456 16:69100478-69100500 AAGCAAAACAGAATGGAGGATGG - Intergenic
1140076893 16:71708268-71708290 AACCACAAGAGAAGTGAAAATGG + Intronic
1140102830 16:71933180-71933202 AAGGACACAAGAAGTGAGGAAGG + Intronic
1140251971 16:73302235-73302257 AAGAGAAAGAGAAGGGAGGAAGG - Intergenic
1140387214 16:74551792-74551814 AAAGAGAAGGGAAGTGGGGAAGG + Intronic
1140388156 16:74560819-74560841 AAGAAAAAAAGAAGGGAGGAAGG + Intronic
1140481343 16:75264465-75264487 GAGCAGAACAGAAGAGAGGAAGG + Exonic
1140682082 16:77395119-77395141 TACCAGAAGAGACCTGAGGAAGG + Intronic
1140683040 16:77404044-77404066 AAGCAGAGGAAAAGGGAGGAAGG - Intronic
1140818364 16:78640952-78640974 AAGAAGAAGAAAAGAAAGGAAGG + Intronic
1140886607 16:79249761-79249783 AAGGAGGAAAGAAGAGAGGAAGG - Intergenic
1140956924 16:79874725-79874747 GAGCAGAAGAGAGGCAAGGATGG - Intergenic
1141529736 16:84637889-84637911 GAGGAGAGGAGAAGAGAGGAGGG - Intergenic
1141713941 16:85716371-85716393 AAGGAGGAGAGAGGAGAGGAGGG + Intronic
1141756231 16:85992918-85992940 AAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141782075 16:86169234-86169256 AAGGGGATGAGAAGTGAGGAGGG + Intergenic
1141782110 16:86169584-86169606 AGGCTAAGGAGAAGTGAGGATGG - Intergenic
1141950814 16:87338405-87338427 AAGGAGCAGAGAAGGGAGGATGG - Intronic
1142251462 16:88993815-88993837 AAGGAGGAGGGAAGAGAGGAGGG - Intergenic
1203113784 16_KI270728v1_random:1469528-1469550 AAGGAGAAGGGAAGGGAAGAGGG - Intergenic
1142526232 17:543774-543796 ATGAAGAAGAGAAGGAAGGAAGG + Intronic
1142958241 17:3535438-3535460 AAGGAGGAAGGAAGTGAGGAGGG - Intronic
1143059108 17:4185160-4185182 AAAGAGAACAGAAGTCAGGAGGG - Intronic
1143087288 17:4425633-4425655 AAGTAGAATAGAGGTTAGGAGGG - Intergenic
1143091300 17:4450400-4450422 GAAAAGAAGAGAAGTAAGGAAGG - Intronic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143266651 17:5642990-5643012 AAAGAGAAGAGAAGAGGGGAAGG - Intergenic
1143303717 17:5929683-5929705 AGGCCCAAGAGAAGTGAGCAGGG + Intronic
1143695440 17:8612223-8612245 AAGCACAAGAGTAGTGATGCTGG + Intronic
1144176792 17:12715263-12715285 AACAAGAAGAGAAGTGATGGAGG - Intronic
1144319336 17:14098947-14098969 AAGCAGAGGAGATGTGAGAGGGG + Intronic
1144603479 17:16641251-16641273 AAGAAAAAGAAAAGTGAGAAGGG - Intronic
1144673582 17:17146731-17146753 AAGCAGGAAGGGAGTGAGGATGG - Intronic
1145034597 17:19532432-19532454 AACCAGAAGAGAGGAGGGGAGGG + Intronic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1145192012 17:20851238-20851260 AAGAAGGAAAGAAGTCAGGATGG + Intronic
1145402231 17:22551275-22551297 AAGAAGGAAAGAAGTCAGGATGG + Intergenic
1145741635 17:27279823-27279845 AAGCAGAAAGGAAGGAAGGAAGG - Intergenic
1146153304 17:30496485-30496507 AAACAAAAGAGAAGTAAGAAAGG - Intronic
1146563780 17:33894287-33894309 AGGAAGAAGAGAAGAGGGGAAGG + Intronic
1146674504 17:34764059-34764081 AAGCAGCAGGGAAGAGAGGGAGG + Intergenic
1146904276 17:36608208-36608230 AAGGACAAGGGAAGAGAGGACGG - Intronic
1147203843 17:38822763-38822785 AAGAAGAAGCCAAGTGAGAAAGG + Intronic
1147272178 17:39281358-39281380 AAACAGAAGAGTTGTGAGAAGGG + Intronic
1147381435 17:40058521-40058543 CAGCAGGAGAGAGGAGAGGAGGG - Intronic
1148060867 17:44835464-44835486 AAGAAAGAGAGAAGTAAGGAAGG + Intergenic
1148180689 17:45602452-45602474 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148180704 17:45602548-45602570 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148183379 17:45622863-45622885 AAACAGAAAAGACGTAAGGAGGG + Intergenic
1148204909 17:45774175-45774197 ATCCAGAAGAGAAGGAAGGAAGG + Intergenic
1148211494 17:45811341-45811363 GAGCAGAGGAGAGGTGTGGAGGG - Intronic
1148265473 17:46222828-46222850 AAACAGAAAAGACGTAAGGAGGG - Intronic
1148268199 17:46243378-46243400 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1148562515 17:48614038-48614060 AAGAAGAAGAAAAGTAAGGCAGG + Intronic
1148638730 17:49169076-49169098 AAGTCAAAGAGACGTGAGGAGGG - Intronic
1148721002 17:49753157-49753179 AAGCAAAAGAGAATTGGGGCCGG - Intronic
1148907938 17:50923024-50923046 AAGCAGAGGAGAAGAGATGGGGG + Intergenic
1148987136 17:51632807-51632829 AAGCAGAAGGGAAGAGAGAGAGG + Intronic
1149032108 17:52095790-52095812 CATCAGAAGGGAAGTGAGGCTGG - Intronic
1149369076 17:55975217-55975239 AAGGAAAAGTGTAGTGAGGAAGG + Intergenic
1149490496 17:57081637-57081659 AATGAGAAGAGAGGTGAGGGTGG - Intergenic
1149503486 17:57173216-57173238 AAGGAGGAGAGAAGGAAGGAAGG - Intergenic
1149642291 17:58211025-58211047 AAGGTGAAGAGAAGTGGGAAAGG + Intronic
1149694026 17:58602209-58602231 AAGCAGCATGGAATTGAGGAGGG - Intronic
1149808927 17:59647830-59647852 AGGAAGAAGAGAAGGGAGGGAGG - Intronic
1149855952 17:60082850-60082872 AAGCATAAGAGTAGTGATGCTGG + Intergenic
1150067378 17:62122942-62122964 AAGGAGAAAAGAAGGAAGGAAGG + Intergenic
1150644258 17:66968439-66968461 AAGAAGAAGAGAGGGGAGGAGGG - Intronic
1150828324 17:68496032-68496054 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1150906817 17:69347031-69347053 GAGCAGAGGAGAGGAGAGGAGGG + Intergenic
1151008837 17:70470015-70470037 TATCAGAAGAGAGGCGAGGAAGG + Intergenic
1151271268 17:72997873-72997895 AAGCACAAGAGTAGTGATGCTGG + Intronic
1151673561 17:75586782-75586804 AGGGAGGAGAGAAGGGAGGAAGG + Intergenic
1151931774 17:77236852-77236874 AAACAGAAGAGAAAAGAGGCTGG + Intergenic
1152229089 17:79105792-79105814 AGGCGGAAGAGAAGTTTGGAGGG + Intronic
1152378394 17:79930054-79930076 GAGGAGAGGAGAAGAGAGGAGGG - Intergenic
1152460774 17:80441316-80441338 AAGCTGAAGAGGAGTGAGGCTGG - Intergenic
1152673089 17:81620705-81620727 CAACAGAAGAGAAGGAAGGAGGG + Intronic
1153427040 18:4976103-4976125 AATCAGGGGAGAAGTGAGGAGGG + Intergenic
1153684582 18:7532961-7532983 AAGCAGAAGAGACATCTGGATGG + Intergenic
1153723603 18:7933184-7933206 AAGCACAGGAGTAGTGATGATGG + Intronic
1153836867 18:8971195-8971217 CAGCAGCAGACAAGTGTGGACGG - Intergenic
1153837268 18:8975153-8975175 AGGTAGATGAGAAGTGGGGATGG + Intergenic
1153861655 18:9216252-9216274 AGGCTGAAGAGAAGGGAGAAGGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154074286 18:11183960-11183982 AAATAGAAGAGAATTGAGGGAGG + Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154269705 18:12908561-12908583 AAGCAAAGAAGAAGAGAGGAAGG + Intronic
1154270802 18:12917539-12917561 AAGATAAAGAGAAGTGAAGAGGG + Intronic
1154438686 18:14367224-14367246 AAGAAAAAGAGAAGGAAGGAAGG - Intergenic
1155243942 18:23889641-23889663 AAGAGGAAGGGAAGGGAGGAGGG + Intronic
1155600953 18:27546879-27546901 AAGAAGAAAAGGAGAGAGGAAGG + Intergenic
1155707299 18:28832087-28832109 AAGCAAAAAAGAAAGGAGGAGGG + Intergenic
1155797382 18:30057563-30057585 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155797396 18:30057663-30057685 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155873406 18:31054888-31054910 AATCAGGAGTAAAGTGAGGAAGG + Intergenic
1155990766 18:32276878-32276900 GGGCAGAAGAGAAGACAGGAGGG + Intronic
1156278541 18:35609183-35609205 AGGCAGAAGAAAAGTAAAGAGGG - Intronic
1156451844 18:37270959-37270981 AAGCAGAACAAAGGTGAGGAAGG + Intronic
1156605015 18:38656079-38656101 AATTATAAGAGAAGTAAGGATGG + Intergenic
1156683192 18:39616141-39616163 AAGCAGAAGAAGAGAGAGAAGGG + Intergenic
1156838273 18:41581735-41581757 AAGAAGAAAAGAAGGAAGGAAGG - Intergenic
1157083383 18:44552573-44552595 ACCCAGGAGAGAAGTGACGAGGG + Intergenic
1157116576 18:44867764-44867786 CAGCAGAAGAGAGGTGGAGAAGG - Intronic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157177504 18:45464980-45465002 AGGCAGGAGAGAAGTAGGGAAGG + Intronic
1157220406 18:45825253-45825275 AGGGAGAGGAGAAGGGAGGATGG + Intergenic
1157226150 18:45866500-45866522 CAGCAGAATAGCAGGGAGGAAGG - Intronic
1157521002 18:48345502-48345524 AAGCACAACAGAAGTGCGCAGGG - Intronic
1157763835 18:50283173-50283195 AAGGAAAAGTGAGGTGAGGAAGG + Intronic
1157813402 18:50714042-50714064 AAGCAGATGAAAAGTTAAGAAGG - Intronic
1158241118 18:55379543-55379565 AGGAAGAAGAGGAGGGAGGAAGG + Intronic
1158357300 18:56635577-56635599 AAGCAGAATAGAAGTTACCAAGG + Intronic
1158441397 18:57477501-57477523 AAGATAAACAGAAGTGAGGAAGG + Exonic
1158739401 18:60122606-60122628 AAGGAGAAGATAAGAAAGGAAGG - Intergenic
1158880909 18:61778963-61778985 AATCAGGACAGACGTGAGGAGGG + Intergenic
1158948333 18:62467518-62467540 ATGTTGAAGAGAAGTGATGATGG + Intergenic
1159131894 18:64289015-64289037 AAGCAAAAGAGAGGGGAGGGTGG + Intergenic
1159194212 18:65090848-65090870 GAGAAGAAGAGGAGTGGGGAAGG - Intergenic
1159230083 18:65595398-65595420 AAGCAGAATAGAAGTCACCAGGG - Intergenic
1159280253 18:66275584-66275606 AAGAAGGAAAGAAGGGAGGAGGG - Intergenic
1159283117 18:66312335-66312357 AAGAAGAAGAGAAGGAAGGGAGG + Intergenic
1159293012 18:66446284-66446306 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1159576320 18:70182482-70182504 CAGCAAAAGGGAAGGGAGGAAGG + Intronic
1159685197 18:71410305-71410327 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
1159850340 18:73519906-73519928 AAGCAGATGACAAATGAGGTAGG - Intergenic
1159851632 18:73532849-73532871 AAGCAGAGGAGAAGGGAAGAGGG + Intergenic
1159877361 18:73827526-73827548 AAGAAGAGGAGAAGAGAGGGTGG + Intergenic
1159895377 18:73991157-73991179 CAGCAGAAGGGAAGAGAGGGTGG - Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159936120 18:74369028-74369050 CAACAGAGGAGAAGTGGGGAAGG - Intergenic
1159979942 18:74766210-74766232 AGGCAGTTGAGAAGTGAGGAGGG + Intronic
1160063515 18:75553040-75553062 AAACGGAAGAGAAGGGAGGATGG + Intergenic
1160110597 18:76026235-76026257 AAGCACAAGAGTAGTGACGCCGG - Intergenic
1160306790 18:77747514-77747536 ACGCAGAAGAAATGTGTGGAAGG - Intergenic
1160925354 19:1542248-1542270 AAGAGGAAGAGAAGGGAGTAGGG - Intergenic
1160965607 19:1745843-1745865 AAGCAGAGGAGAGGGGAGCAGGG + Intergenic
1161214298 19:3085727-3085749 AAGTAGAAGAGGAGAGGGGAGGG - Intergenic
1161232933 19:3184144-3184166 AGGCAGAAGTCAAGTGACGAAGG - Intergenic
1161346575 19:3771425-3771447 CAGCAGAAGAGAAGCTAGGAAGG - Intronic
1162226309 19:9225512-9225534 AAGGAGAGGGGAATTGAGGATGG + Intergenic
1162265974 19:9574656-9574678 AGGCAGAGGAGAAGAAAGGAAGG + Intronic
1162342258 19:10098526-10098548 AAGCAAAAGCGAAGGGAGGCTGG + Intronic
1163050983 19:14683339-14683361 TAGAAGAAGAGAACTGAAGAAGG + Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163171172 19:15532259-15532281 AAGAAGAAGAGAAGGGAGGAGGG - Intronic
1163304519 19:16469465-16469487 AAGCAGAAGAGAGCTGAGCAGGG + Intronic
1163927273 19:20357676-20357698 ACGCAGAGGAGAACAGAGGAAGG + Intergenic
1164015540 19:21253478-21253500 CAGCACAACAGAACTGAGGATGG + Intronic
1164700356 19:30280355-30280377 AAGGAGAACAGACGGGAGGATGG - Intronic
1164794377 19:31014488-31014510 AGGGAGAAAAGAAGGGAGGAAGG + Intergenic
1164957815 19:32402238-32402260 AAGAGAAAGAGAAGGGAGGAGGG + Intergenic
1165421310 19:35723327-35723349 AGGCAGAAGAGGAGTGAGGTAGG - Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165775582 19:38402802-38402824 CAGCAGAAGACAACTGAGGGAGG + Intergenic
1165910275 19:39221713-39221735 AAGGAGAAGAAAAGTAAGTAAGG - Intergenic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1165911342 19:39230105-39230127 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
1165952804 19:39483531-39483553 AACCAGAAGGGGAGAGAGGAAGG - Intronic
1166096521 19:40542647-40542669 AAGCAGAACAGGGGGGAGGAGGG - Intronic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1166916339 19:46198107-46198129 AAACAAAAAAGAAGGGAGGAAGG - Intergenic
1167000117 19:46740889-46740911 AAGCTGAAGAGAAGTTAGCCAGG + Intronic
1167132989 19:47599872-47599894 AAGCAGAAGCGAACTGCGGCAGG - Intergenic
1167245384 19:48370026-48370048 AGGCAAAGGAGAAGGGAGGATGG + Intronic
1167286655 19:48602221-48602243 AAGAAGGAGAGGAGGGAGGAGGG + Intronic
1167417990 19:49386969-49386991 GAGCAGAAGGGAAGGGAGGCGGG + Intergenic
1167581021 19:50342870-50342892 AAGGAGAAGAGAAGAGAAGAGGG + Intronic
1167744369 19:51342005-51342027 AGGCTGCAGAGAAGAGAGGAAGG + Exonic
1168112384 19:54200729-54200751 AAGCAGTGGAGACGTGAGGCTGG - Exonic
1168259379 19:55184944-55184966 ATGCAGAAGAGAAGGGAGAAAGG - Intronic
1168397937 19:56064893-56064915 AAGCAGAAAAGAGCTGGGGATGG - Intergenic
1168450054 19:56459354-56459376 AAGCAGAAGTGAAGACAGCAAGG - Intronic
925057974 2:870049-870071 GATCAGAAGAGCAGTGAGGCTGG - Intergenic
925188021 2:1862861-1862883 AAGAAGGAGAGAGGTGAGTAGGG + Intronic
925372940 2:3360932-3360954 AAGGGGAGGAGAAGGGAGGAGGG + Intronic
925445567 2:3923981-3924003 AAGGAGAAGAGAGGAGAGGAGGG - Intergenic
925459144 2:4044750-4044772 AAGCAGATGAGAAATTAGGGAGG + Intergenic
925659158 2:6184141-6184163 AAGGAGAAGAGAAGGGTGGGAGG + Intergenic
925666648 2:6264072-6264094 AAGCAAAGGAGAAGAGAGGACGG + Intergenic
925791036 2:7488608-7488630 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791049 2:7488654-7488676 AAGTAGAAAGGAAGGGAGGAAGG + Intergenic
925791080 2:7488759-7488781 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791094 2:7488805-7488827 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791114 2:7488875-7488897 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791155 2:7489015-7489037 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791186 2:7489123-7489145 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791200 2:7489169-7489191 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925972294 2:9113965-9113987 AAGTAGGAGAGAAGTAAAGAAGG + Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926238183 2:11065640-11065662 AGACAGGGGAGAAGTGAGGAAGG + Intergenic
926292034 2:11538977-11538999 GAGGAGAAGAGAGGAGAGGAGGG - Intronic
926351783 2:12002085-12002107 AAGAGGAAGGGAAGTAAGGAAGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926760924 2:16278410-16278432 AAGTTGAGGAGAAGGGAGGATGG - Intergenic
926827375 2:16920144-16920166 AAGAAGAAAAGAAATAAGGAAGG + Intergenic
926933352 2:18062632-18062654 AAGGAGGAGAGAGGAGAGGAAGG - Intronic
927090892 2:19711727-19711749 AGGAAGAAGAGAAGAGAGGAAGG + Intergenic
927197153 2:20555879-20555901 ATGCAGAGGTGAAGTGGGGAAGG - Intergenic
927280837 2:21305024-21305046 AAGGAGAAGGGAAGTGGGGAAGG + Intergenic
927438379 2:23089998-23090020 AAGAAGAGGAGGAGAGAGGAGGG + Intergenic
927439251 2:23099664-23099686 AAGATGAATAGAAGTGATGAGGG + Intergenic
927445904 2:23161373-23161395 AAGCTGAAGAACAGAGAGGATGG + Intergenic
928043558 2:27903946-27903968 AAGCACAAGAGTAGTGATGCTGG - Intronic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
928360278 2:30657030-30657052 AGGAAGAGGAGAAGGGAGGAAGG - Intergenic
928454743 2:31409464-31409486 AACCAGAAGAAAAGAGAAGAAGG - Intronic
928619699 2:33076341-33076363 AAGAAGAAGAGAAGAGAGGAAGG + Intronic
928623296 2:33113385-33113407 AAGCAGGAAAGAGATGAGGATGG + Intronic
928789030 2:34928825-34928847 AAGGACGAGAGAAGGGAGGAAGG - Intergenic
929089601 2:38201765-38201787 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
929407971 2:41665140-41665162 AAGTTGAAGAAATGTGAGGAGGG - Intergenic
929865845 2:45716681-45716703 AAGAAGAAGAGAAGGAAGGAAGG + Intronic
929959087 2:46482988-46483010 CAGAAAAAGAGAAGAGAGGAAGG - Intronic
930142555 2:47967509-47967531 AAGCAGAAGGGAAGGGAGATAGG - Intergenic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
930359920 2:50364546-50364568 AAGCAGGAGAGAATTGACAAGGG - Intronic
930472104 2:51829824-51829846 AAGGAGAAGAGAAGAGGGGAGGG - Intergenic
930506043 2:52283902-52283924 AAGCAGAAGGGAAGGAAGGGGGG + Intergenic
930596187 2:53390985-53391007 AAGAAGAGGAGAAGTAAGGCAGG + Intergenic
930607855 2:53510864-53510886 AAGGAGAAGAGAAGAAAGGTAGG + Intergenic
930704517 2:54490969-54490991 ACCCAAAAGACAAGTGAGGAGGG + Intronic
930837226 2:55807245-55807267 ATGCAGAAGAGGAGTGCTGAAGG - Intergenic
931201632 2:60103284-60103306 AAGGAGGAGAGAAGTGAAGAGGG + Intergenic
931245652 2:60490479-60490501 AAGAAGAAGAAAAGCCAGGAAGG - Intronic
931829780 2:66038740-66038762 CAGCAAAAGAGAAGGAAGGAGGG + Intergenic
931894774 2:66716535-66716557 GAGGTGAAGAGAAGTGAGGGAGG - Intergenic
931925469 2:67067579-67067601 AAGCATAAGAGAAAAGAGGCGGG - Intergenic
932414242 2:71564264-71564286 AAACAGAAGAGATGGGAGAAAGG - Intronic
932436099 2:71703322-71703344 GAGGAGGAGAGAAGGGAGGAGGG + Intergenic
933223844 2:79722584-79722606 AGACAGAATAGAAGAGAGGAGGG - Intronic
933243946 2:79954115-79954137 CAGCAGGAGAGAAGTGAGTGAGG + Intronic
933422830 2:82073136-82073158 AAGTGTAAGAGAAGTGAGGTTGG + Intergenic
933510723 2:83238199-83238221 AAGCACAAGAGTAGTGATGCTGG - Intergenic
933877895 2:86637255-86637277 GAAGAGAAGAGAAGAGAGGAGGG + Intronic
933936595 2:87208986-87209008 AAAAAGAAGAGAAGAGAAGAGGG - Intergenic
934056827 2:88258330-88258352 AAGGAGAAGAGAGGAGAGGGAGG - Intergenic
934144563 2:89078709-89078731 GAGCAGAAGGGAAATGAGGGAGG - Intergenic
934224689 2:90121840-90121862 GAGCAGAAGGGAAATGAGGGAGG + Intergenic
934249390 2:90336205-90336227 AAGAAGAAAAGAAGGAAGGAAGG - Intergenic
934260191 2:91467265-91467287 AAGAAGAAAAGAAGGAAGGAAGG + Intergenic
934331889 2:92075701-92075723 AAGCGGAAAAGAAGAAAGGAAGG + Intergenic
934518321 2:95003446-95003468 AAGCAGGAGAGAAGTGGGTGTGG + Intergenic
934524292 2:95042120-95042142 GAGGAGAAGAGAGGAGAGGAGGG + Intronic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
935098533 2:99970304-99970326 AAGCAGAAGGGGAGAAAGGATGG - Intronic
935119223 2:100166795-100166817 AAGCACAAGAGTGGTGATGATGG - Intergenic
936009645 2:108917259-108917281 GAGCAGAACAGAGGTGGGGAAGG + Intronic
936231982 2:110710832-110710854 AAGAAGAATAGAAGTGGAGAGGG + Intergenic
936356549 2:111756842-111756864 AAAAAGAAGAGAAGAGAAGAGGG + Intergenic
936907241 2:117551195-117551217 AAGAAGAAGAGCAGAGAGGGAGG + Intergenic
936913143 2:117613324-117613346 CACAAGAAGAGAAGTGGGGAAGG + Intergenic
937480104 2:122249377-122249399 AGTCAGAAGAGAAGTGGGTAGGG - Intergenic
937524711 2:122754371-122754393 AAGCAGAAAAGGGATGAGGAAGG - Intergenic
938269778 2:129959382-129959404 GAAGAGAAGAGAAGAGAGGAGGG - Intergenic
938519116 2:132048624-132048646 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
938549769 2:132369257-132369279 AACCAGAAGACAAGTGAGCCGGG + Intergenic
938551972 2:132390951-132390973 AACTAGAAGAGAGGTGAGAAAGG - Intergenic
939000521 2:136728659-136728681 AAGCAGCATAGGAGTGAAGATGG - Intergenic
939104288 2:137931191-137931213 AAGAAAAAGAGAAGGAAGGAAGG + Intergenic
939434169 2:142152652-142152674 AAGAAGAAGCGAAGGGAGGAAGG - Intergenic
939564020 2:143765537-143765559 AAGCAGAAGAAAAGGGAAAATGG + Intronic
939597179 2:144139666-144139688 AGGCAGGAGATAAGTGAGGAAGG + Intronic
939623229 2:144446325-144446347 AGGGAGAAAAGAAGGGAGGAAGG - Intronic
939952140 2:148488137-148488159 AAGCAGGACAGAATTTAGGACGG + Intronic
940179731 2:150918634-150918656 AAGGAAAAGAAAAGAGAGGAGGG + Intergenic
940268054 2:151860990-151861012 AAGCAGAGCAGAATGGAGGAAGG + Intronic
940578449 2:155546147-155546169 AAGAAGGAAAGAAGGGAGGAGGG + Intergenic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
941102010 2:161307210-161307232 AAATAAAAAAGAAGTGAGGAAGG + Intergenic
941281993 2:163563662-163563684 AAGCACAAGAGTAGTGATGCTGG + Intergenic
941392908 2:164936940-164936962 AATCAGAAGAGAATAAAGGATGG + Intronic
942442788 2:176053324-176053346 AAGCAAAAGAGAAGACAGGGAGG + Intergenic
942756930 2:179352048-179352070 AAGCTGATGACAAGTCAGGAAGG - Intergenic
942831324 2:180239612-180239634 AAGAAGAAAAGAAGGGAGGGAGG - Intergenic
942956047 2:181774627-181774649 AAGCACAAGAGTAGTGATGCCGG - Intergenic
943289334 2:186048549-186048571 AAGCACAAGAGTAGTGAAGCTGG - Intergenic
943462272 2:188184106-188184128 AAGCACAAGAGTAGTGATGCTGG - Intergenic
943503948 2:188730110-188730132 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
943611391 2:190038986-190039008 AAGAAGAAGAGAAGAAAGAAAGG - Intronic
943786543 2:191883814-191883836 AAGCAGAAAGGAACAGAGGAAGG - Intergenic
943806033 2:192127418-192127440 AAGTAGGAGAGAAGGCAGGAAGG - Intronic
943845828 2:192646223-192646245 AAGAAGAAAAGAAGTAAAGAAGG + Intergenic
944363420 2:198886760-198886782 AATCAGAAGAGAAGTGTGTTAGG + Intergenic
944495009 2:200298306-200298328 CTGCAGAAGACAAGTCAGGAGGG - Intergenic
944565825 2:200990369-200990391 ATCCAGTAGTGAAGTGAGGAAGG - Intronic
944715533 2:202373523-202373545 AAGCACAAGAGTAGTGATGCTGG - Intergenic
945515056 2:210752996-210753018 AAAAAGCAGAGAAGTGAGGTAGG - Intergenic
945563392 2:211366232-211366254 TAGCACAAGAGAAGTGAGCAAGG - Intergenic
945663237 2:212711494-212711516 AATAAAAAGAGAAGTGAAGAGGG - Intergenic
945670177 2:212793103-212793125 AGTCACAAGAGAAGTGAGGAAGG + Intergenic
945705146 2:213221367-213221389 AAGCAGTAGAACAGAGAGGAAGG + Intergenic
945714684 2:213343807-213343829 AAGCTGAAAAGAAATGAGCAGGG + Intronic
945746534 2:213725443-213725465 AGACAGAACAGAAATGAGGATGG - Intronic
945792255 2:214319413-214319435 GAGCAGAAGAGAAGAGACTAGGG + Intronic
946185005 2:217975795-217975817 AGCCAGAAAAGCAGTGAGGAGGG - Intronic
946329095 2:218999885-218999907 CAGCAGAAGAGAAATGGAGAAGG - Intergenic
946822727 2:223647097-223647119 AAGTAGAAGGGAAGTGTGAAAGG - Intergenic
946878041 2:224149986-224150008 AAGTAGAAGAGAAGAGAAAATGG - Intergenic
947037755 2:225878844-225878866 AGGAAGAAAGGAAGTGAGGAAGG - Intergenic
947108331 2:226691572-226691594 AAGCAGGTGAGGAGTGAGGTGGG - Intergenic
947459832 2:230294043-230294065 AAGCACAAGAGAAGGGAAAATGG + Intronic
947470072 2:230393188-230393210 AAGCACAAGAGAAGGGAAAATGG + Intronic
947528615 2:230894546-230894568 AACCAAAACAGAAGTGAGTAAGG + Intergenic
947675539 2:231976040-231976062 AAGCAGATGAGAAGGGAGGTTGG + Intronic
947702484 2:232246130-232246152 CAGCAGAAGAGCAGGGAGGATGG + Intronic
947808360 2:232983554-232983576 AAGAAGGAGAAAAGTAAGGATGG + Intronic
947965384 2:234276377-234276399 AAACAGAGGAAAAGTGGGGAAGG - Intergenic
948058349 2:235026135-235026157 AAGCAGAGGAGAGGGGAGGCAGG + Intronic
948091917 2:235302138-235302160 AGGAAGAAGAGGAGGGAGGAGGG - Intergenic
948502196 2:238403757-238403779 AGCCTGGAGAGAAGTGAGGACGG - Intergenic
948565515 2:238883945-238883967 ATGCAGAGGAGAAGGAAGGACGG - Intronic
948737142 2:240016592-240016614 AAGCAGAGGGGATGTGGGGAGGG - Intronic
1169063932 20:2682106-2682128 AAGAAGAAGAGAGGGGAAGAAGG + Intergenic
1169092615 20:2870910-2870932 GAAGAGAAGAGAACTGAGGAAGG - Intronic
1169112045 20:3040516-3040538 AAGTAAAAGAGGAGTGAAGAGGG - Intergenic
1169250071 20:4053544-4053566 AAGGAGCGGAGAAGGGAGGATGG + Intergenic
1169465998 20:5839343-5839365 AAGCTGGAGAGAAGTGAGAAGGG - Intronic
1169490063 20:6063743-6063765 AAGCAGGAGAGGAGTGAGTTAGG + Intergenic
1169732969 20:8806465-8806487 AAGTAGAGGAGATGAGAGGAAGG - Intronic
1169750726 20:8990622-8990644 AAGGAAAAGAGAAGGAAGGAAGG + Intergenic
1170020663 20:11833864-11833886 AAGAAGAAAAGAAAGGAGGAAGG + Intergenic
1170233407 20:14075076-14075098 AAGCACAAGAGTAGTGATGGTGG + Intronic
1170272153 20:14539372-14539394 AAGCAGGAGTCAAGGGAGGATGG - Intronic
1170370227 20:15640147-15640169 GAGAAAAAGAGATGTGAGGAAGG + Intronic
1170419805 20:16181383-16181405 GAGCAGAAGAGAAGGGAGATGGG - Intergenic
1170501808 20:16982422-16982444 AAGCAGGAGGGAAGGGAGGGAGG - Intergenic
1170501836 20:16982510-16982532 AAGAAGAAAAGAAGGGAGGAAGG - Intergenic
1170683240 20:18545395-18545417 AAGAAGACGAGAACTGCGGAAGG + Intronic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1171010759 20:21508222-21508244 AGGAAGGAGAGAAGTGAGGAAGG + Intergenic
1171265661 20:23770162-23770184 AAGCGGCACAGAACTGAGGATGG + Intergenic
1171774574 20:29353220-29353242 AAGAAAAAGAGAAGAAAGGAAGG - Intergenic
1172212635 20:33211784-33211806 AAGCAGAAGAGAAGCCAAGTTGG + Intergenic
1172393610 20:34583461-34583483 AGGCAGAAGAGAAGACAGCAGGG + Intronic
1172756342 20:37287563-37287585 AATCAAAAGAGAGGTGATGAGGG - Intergenic
1172788730 20:37487682-37487704 AAGGGGAAGACAAGTGAGGGTGG - Intergenic
1172870853 20:38134741-38134763 AAGCAGCAGAGAAAGGAGGCAGG + Intronic
1173012387 20:39193976-39193998 AAGCACAAGAGTAGTGATGCTGG - Intergenic
1173201299 20:40957197-40957219 AAGCGGGAGAGAAGGGAGAAAGG + Intergenic
1173551648 20:43937056-43937078 AAGCAGAACAGGTGTGATGAAGG + Intronic
1173619541 20:44426234-44426256 AAGGAGAGGTGAAGAGAGGAGGG + Intronic
1174115324 20:48222998-48223020 AAGCAGGAGGTCAGTGAGGAGGG + Intergenic
1174190269 20:48735439-48735461 AAACCAAAGAGAAGGGAGGATGG + Intronic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174724327 20:52845382-52845404 AAGAAGGAAAGAAGTGAGGCAGG - Intergenic
1174884197 20:54314071-54314093 AGAAAGAAGAGAAGTAAGGAGGG + Intergenic
1175021837 20:55859318-55859340 AGGCAGAAGAGATGTGGAGATGG + Intergenic
1175170219 20:57074920-57074942 ATGCAGAAGAGACCTGGGGACGG + Intergenic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1176156025 20:63621215-63621237 AAGTAGAACAGAAGTGACCAGGG + Intronic
1176366586 21:6036748-6036770 AATCAGAAGAGCAGTGATGCTGG - Intergenic
1176457000 21:6922212-6922234 AAGAAAAAGAGAAGGAAGGAAGG + Intergenic
1176835173 21:13787274-13787296 AAGAAAAAGAGAAGGAAGGAAGG + Intergenic
1177345896 21:19870289-19870311 AACCAAAAGAGAATTGAGGTGGG + Intergenic
1177418847 21:20828741-20828763 AAACAGAAGCAAAGTTAGGAAGG + Intergenic
1177429552 21:20974137-20974159 AAGCAGAAGGGAAGGGAAGCAGG + Intergenic
1177760074 21:25393127-25393149 AGGCAGAAGAGAAGATGGGAGGG + Intergenic
1177900984 21:26914747-26914769 AAGCAGAAGAGAAAGGCAGAAGG - Intergenic
1178146171 21:29743029-29743051 AAAAAAAAAAGAAGTGAGGAAGG - Intronic
1178150830 21:29791495-29791517 AAGGAGAAGGGAAGTGGGGGGGG + Intronic
1178170016 21:30030159-30030181 AAGAAGAATAGAAGGGAGGTTGG + Intergenic
1178419507 21:32432398-32432420 AAGCAGAACAGAAGAAAGAAAGG + Intronic
1178581914 21:33845127-33845149 AAGCAGCAGAGAAATGAGTGGGG + Intronic
1178746424 21:35255108-35255130 AAACAGAGGAGAGATGAGGAAGG + Intronic
1178792290 21:35711717-35711739 AAGCAGAAAGGAAGTGGAGAAGG + Intronic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1178924321 21:36762332-36762354 AAGAAGCAGAGAAGAGAGCAGGG + Intronic
1179016309 21:37596810-37596832 AGGCAGAGGAGAACAGAGGAAGG - Intergenic
1179163461 21:38916802-38916824 AGGAAGAAGAGAAGGAAGGAGGG + Intergenic
1179163468 21:38916839-38916861 AGGAAGAAGAGAAGGAAGGAGGG + Intergenic
1179163478 21:38916884-38916906 AGGAAGAAGAGAAGGAAGGAGGG + Intergenic
1179352826 21:40629490-40629512 AACAAGAGGAGAAGTGAGGAAGG + Intronic
1179756931 21:43501797-43501819 AATCAGAAGAGCAGTGATGCTGG + Intergenic
1180463976 22:15594249-15594271 GAAAAGAAGAGAAGAGAGGAGGG + Intergenic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181722648 22:24787590-24787612 GAGGAGAAGAGAAGAGAGAAGGG - Intergenic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181789213 22:25250488-25250510 AAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1181912862 22:26254342-26254364 AGGAAGAGGAGAAGTGAGGAAGG + Intronic
1181976199 22:26732065-26732087 AAGCAGCAGAGCAAGGAGGAGGG - Intergenic
1181992403 22:26847405-26847427 AAGAAATAGGGAAGTGAGGATGG - Intergenic
1182083220 22:27543652-27543674 AAGGAGGAGGGAAGGGAGGAGGG - Intergenic
1182410490 22:30181025-30181047 AAAGAGAAGAGAAGAGAGGGAGG - Intergenic
1182485233 22:30635335-30635357 AAGAAGCAGGGTAGTGAGGAGGG - Intergenic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182753035 22:32657108-32657130 AAAGAAAAGAGAAGTGAGGGTGG - Intronic
1183153153 22:36053724-36053746 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183279766 22:36925733-36925755 AAGCAGGTGAGGAGGGAGGAAGG - Intronic
1183354538 22:37351143-37351165 AAGGAGGAGAGGAGGGAGGAGGG - Intergenic
1183373556 22:37449293-37449315 AGGCCCAAGAGAACTGAGGAAGG + Intergenic
1183502558 22:38189401-38189423 AAGCACAAGAGAAGGGACAAAGG - Intronic
1183616770 22:38950498-38950520 AAGGAAAGGAGAAGAGAGGAGGG + Intergenic
1184003999 22:41695730-41695752 AAGCAGATGGGAAGTGAGAATGG + Exonic
1184463770 22:44657330-44657352 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
1184642510 22:45879920-45879942 AACCAGAAGAGAAATGTGGCAGG - Intergenic
1184724431 22:46335463-46335485 CAGAAGAAGAGCAGTGAGGCCGG + Exonic
1185396237 22:50591225-50591247 AAGCAGAAAAGAAGTGGAAATGG - Intronic
949798959 3:7882154-7882176 ATGTTGAACAGAAGTGAGGAGGG - Intergenic
950084141 3:10245302-10245324 AAGCAGAGGAGAACAAAGGAAGG - Intergenic
950360798 3:12448262-12448284 AAGAAGAAGAGAAGGAAGGGAGG + Intergenic
950360811 3:12448305-12448327 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
950360861 3:12448521-12448543 GAGAAGAAGAGAAGGAAGGAGGG + Intergenic
950360876 3:12448581-12448603 AAGAAGAAGGGAAGGAAGGAGGG + Intergenic
950360905 3:12448713-12448735 GAGAAGAAGAGAAGGAAGGAGGG + Intergenic
950360919 3:12448773-12448795 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950616519 3:14164368-14164390 AGGCAGCAGTGCAGTGAGGAGGG - Intronic
950733651 3:14986477-14986499 AAGAAGGAGAAAATTGAGGAAGG + Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951105461 3:18736889-18736911 AAACAGACAAGATGTGAGGAAGG + Intergenic
951114611 3:18845444-18845466 AAGAAGAAAGGAAGAGAGGAAGG - Intergenic
951440227 3:22714263-22714285 AAGCACAAGAGTAGTGATGCTGG + Intergenic
951800265 3:26588008-26588030 CAGCAGAAGAGAAATTAGGAAGG - Intergenic
951813379 3:26726509-26726531 AAGGAGTAGAGAGCTGAGGAGGG - Intergenic
951834211 3:26963245-26963267 AGGCTGAAGTGAAGTTAGGAAGG - Intergenic
952039723 3:29247534-29247556 GAGCAACAGAGAGGTGAGGAAGG - Intergenic
952179659 3:30904451-30904473 CAGCAGAAGAGGGCTGAGGATGG - Intergenic
952340972 3:32446768-32446790 AAGCAAGAGAGAGGGGAGGAAGG - Intronic
952405499 3:33001147-33001169 GAGGAGAAGAGAAGAGAGAAAGG - Intronic
952679592 3:36075074-36075096 AACTAGAAGAGGAGTGAAGATGG - Intergenic
952701146 3:36328970-36328992 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
952863564 3:37834998-37835020 AAGCAGAAGAGAAGCGACGCTGG + Intergenic
953009169 3:39007864-39007886 AAGTTGGAGAGAAGTGTGGATGG + Intergenic
953046310 3:39296655-39296677 AGGAAGAAGTGAAGTGAGGCAGG + Intergenic
953057439 3:39399325-39399347 AAGCAGGGGAGAGGTCAGGATGG + Intergenic
953169613 3:40495425-40495447 AAGAAGGAGAGGAGTGAGGAGGG - Intergenic
953305164 3:41822223-41822245 GGACAGGAGAGAAGTGAGGAAGG - Intronic
953390281 3:42529936-42529958 AAGAAGAAGAGAAGAGGGGAGGG - Intronic
953443893 3:42945914-42945936 AAGGAGGAGAGAAGTGGAGACGG - Intronic
953461767 3:43087100-43087122 AAGCAAAATAGAAGAAAGGAAGG + Intronic
953540632 3:43814620-43814642 AAGCAAAAGAGAAGAGAGGAAGG - Intergenic
953655028 3:44844230-44844252 AGGCAGGAGAGATTTGAGGATGG + Intronic
953831347 3:46300077-46300099 AAGGAAAAGAGAGGAGAGGAAGG + Intergenic
954033733 3:47838834-47838856 CAGCAGAAGAGAAATGCAGATGG - Intronic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
954871491 3:53770748-53770770 AAACAGAAGAGAAAGCAGGAAGG + Intronic
954898862 3:54001498-54001520 AAGCTGGAGAGGAGTCAGGAAGG + Intergenic
955159190 3:56447431-56447453 AGGGAGACGAGAAGTGGGGAAGG + Intronic
955499989 3:59573975-59573997 AAGCATAAGAGTAGTGATGCTGG - Intergenic
955519581 3:59761997-59762019 AAGCATAAGAGTAGTGATGCTGG - Intronic
955556763 3:60146427-60146449 AGGAAAAAGAGAAGAGAGGATGG - Intronic
955990547 3:64622378-64622400 AAGCAGAAGAAAAGGGTGGTGGG + Intronic
956329598 3:68091398-68091420 AAGCACTGGAGAAGTGAGAATGG - Intronic
956431940 3:69195653-69195675 GAGCAGAAGAGAAGGTAAGATGG + Intronic
956669701 3:71675123-71675145 AAGGAGAAGAGCAGAGAAGATGG - Intergenic
956759644 3:72428995-72429017 GAGCAGAAGAGAACTTCGGAAGG + Intronic
956770574 3:72522626-72522648 AAGCAAAGGAGATGTGAGCAGGG - Intergenic
956777154 3:72574948-72574970 CAGCAGTGGAGAAGTGAGGTGGG + Intergenic
957033487 3:75270563-75270585 AAGCACAAGAGTAGTGATGCTGG + Intergenic
957302295 3:78407945-78407967 AACCAGAAGCGAGGTGAGGAGGG - Intergenic
957385570 3:79491707-79491729 TACCACAAGAGAAGTGAGGTAGG + Intronic
957416912 3:79917373-79917395 AAGGAAAAAGGAAGTGAGGAAGG + Intergenic
957851992 3:85820155-85820177 AAGAAGAATAGAGGAGAGGAAGG + Intronic
958039236 3:88206564-88206586 AAGCAGGAGAGAGGGGAGGAAGG + Intergenic
958137840 3:89519352-89519374 AAAAAGAAAAGAAGGGAGGAAGG - Intergenic
958144882 3:89612072-89612094 GAGAAAAAGAGAAGGGAGGAAGG - Intergenic
958652267 3:96952479-96952501 AAGCAAAAGAGAAACGAAGAGGG - Intronic
958896870 3:99839123-99839145 AAACAGATGAGAATTGAGCAGGG - Intronic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959417317 3:106091227-106091249 AATCAGAAGAGCAGACAGGAAGG + Intergenic
959540693 3:107534467-107534489 AAGAAGAAGAGAAGGAGGGAGGG - Intronic
959617072 3:108360489-108360511 AAGCACAAGAGTAGTGATGCTGG - Intronic
959657121 3:108820670-108820692 GAGCAGAAGAGACATTAGGAAGG - Intergenic
959909164 3:111743676-111743698 AAGCAGAATATAAGTCAGAAGGG + Intronic
960285486 3:115823774-115823796 AAGCAAAAGAGAAGCTAAGATGG + Intronic
960290811 3:115882158-115882180 AAGCAGGAGAGAAGTGGGATAGG - Intronic
960862951 3:122169878-122169900 AAGAAGAAGAGAGATGAAGAGGG + Intergenic
960863093 3:122171579-122171601 AATCACAAGAGAAGTGAAAATGG - Intergenic
961012266 3:123444362-123444384 AGGCAGCAGAGAGGTGAGGTGGG + Intronic
961026308 3:123560954-123560976 TAGCAGAAGAGAACTCTGGAAGG - Intronic
961340119 3:126212273-126212295 AAGAAGAAAGGAAGGGAGGAAGG + Intergenic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
961517572 3:127447571-127447593 AGGGAGAAGAGATGTGATGACGG + Intergenic
961522755 3:127476713-127476735 AGGAAGGAGAGAAGGGAGGAAGG + Intergenic
961572464 3:127809683-127809705 CAGCAAGAAAGAAGTGAGGATGG + Intronic
961573032 3:127813966-127813988 AGGAAGAAGAGAAGAGGGGAAGG - Intronic
961862369 3:129927092-129927114 AGGGAGAACAGAAGTAAGGAGGG + Intergenic
961884453 3:130086989-130087011 AAGCAGAAGAGAAGAAAGAAAGG - Intronic
962029670 3:131586562-131586584 AAGCAAGATAGAAGTGTGGAAGG - Intronic
962501200 3:135994890-135994912 AAGCAGCAGATAAGTTAGGATGG - Intronic
962592990 3:136909888-136909910 AACCGTAAGAGAAGTGAGGTGGG - Intronic
962803443 3:138909826-138909848 ATGGAGAAGAGAGGGGAGGAAGG + Intergenic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
962914631 3:139888824-139888846 GAGGAGAAGAGAGGAGAGGAGGG - Intergenic
962945437 3:140164968-140164990 AAATAGGAAAGAAGTGAGGAAGG + Intronic
963035764 3:141027212-141027234 AAGCCACTGAGAAGTGAGGAGGG - Intergenic
963112981 3:141701810-141701832 AAGCAGAACAGGACTGACGAGGG + Intergenic
963406316 3:144868227-144868249 AAGCAGGAGAGAGGGGAGGGAGG - Intergenic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963534316 3:146509004-146509026 AAGCAGGAAAGAAGAAAGGAAGG - Intergenic
963626321 3:147678552-147678574 AAGAAGAAAAGAAGGAAGGAAGG - Intergenic
963643482 3:147884621-147884643 AGGCATAAGAGAAGTGAAGGTGG - Intergenic
963652922 3:148006897-148006919 AAGGAGAAGAGAAGAGAAAAAGG - Intergenic
964245040 3:154642094-154642116 AAGCTGTAGCTAAGTGAGGAGGG - Intergenic
964653919 3:159045067-159045089 CAGCAGAGGAGAAGAGAGGAAGG - Intronic
964778360 3:160306500-160306522 AAGCAGTTGAGATGTGGGGAAGG - Intronic
965491564 3:169343087-169343109 AATCAGAAGAGGAGAGAAGATGG + Intronic
965654369 3:170968249-170968271 AAGAAACAGGGAAGTGAGGAAGG + Intergenic
965757710 3:172041441-172041463 GAGGAGAAGAGAAGGAAGGAAGG - Intronic
965996522 3:174889537-174889559 TGGAAGCAGAGAAGTGAGGATGG - Intronic
966005589 3:175007846-175007868 AAGCATAACAGTAGTGACGATGG - Intronic
966024777 3:175263747-175263769 ATGAAGAAAAGAAGGGAGGAAGG + Intronic
966154539 3:176901878-176901900 AAGAATAAGAAAAGAGAGGAAGG + Intergenic
966205126 3:177398322-177398344 AAGCAGGAGAGAGGGGAGGGAGG + Intergenic
966314507 3:178630683-178630705 AAGAAAAGGAGAAGGGAGGAGGG - Intronic
966470902 3:180287847-180287869 GATAAGAAGAGAAGAGAGGAAGG - Intergenic
966754143 3:183352722-183352744 ATCCAGAAGGGAAGTGAGGAGGG - Intronic
966765715 3:183460165-183460187 AAGAAGATGGGAAGTAAGGAAGG - Intergenic
966772577 3:183517353-183517375 GAGGGGAAGAGAGGTGAGGATGG - Intronic
966819190 3:183911431-183911453 AAGCTGAAGAGACCTCAGGAAGG - Intergenic
966929725 3:184668481-184668503 AAGTAGGGGAGAAGTGGGGAAGG + Intronic
966956051 3:184880298-184880320 GAGCAGAAGAGAAGTGGGTGTGG - Intronic
967193782 3:187009073-187009095 AAGAAGAAAAGAAGGGAGGGAGG - Intronic
967478621 3:189949313-189949335 AAGGGGAAGAGAAGGGAAGAGGG - Intergenic
967553372 3:190825867-190825889 AAGGAAAAGAGAAGGAAGGAAGG - Intergenic
967664887 3:192159085-192159107 AGGAAGTAGAGAAATGAGGAGGG - Intronic
967788670 3:193523985-193524007 AAGCAGAAGGGAAGTGGGCATGG - Intronic
969157754 4:5226672-5226694 AAGCACAAGAGAAGTGAAGTTGG + Intronic
969178208 4:5416188-5416210 AAACAGAAGAGAAGGAAGGAAGG - Intronic
969195608 4:5561421-5561443 ATGCAGGAGAGAAGAGATGATGG - Intronic
969264781 4:6057344-6057366 GACCAGCAGAGAAGGGAGGAGGG - Intronic
969270326 4:6095182-6095204 AAGAAGAAAGGAAGGGAGGAGGG + Intronic
969471084 4:7389709-7389731 AGGCAGTGGAGAAGTGAGAAAGG + Intronic
969504297 4:7574622-7574644 AGGAAGGAGAGAAGGGAGGAAGG + Intronic
969820326 4:9715298-9715320 AAGCAGAAGAGAAGAAAGAAAGG + Intergenic
969861563 4:10039872-10039894 AAGAAGAAAGGAAGGGAGGAGGG + Intronic
970059055 4:12009619-12009641 AAGAAGGAGGGAAGTAAGGAAGG - Intergenic
970365061 4:15350120-15350142 AAGCAGGAAAGAAGGGAGGGAGG + Intronic
970454414 4:16208332-16208354 AAACAGAAAAGAACTGAGAATGG - Intronic
970614380 4:17754253-17754275 AAGAAGAAGAGAATTTAGGCTGG + Intronic
970950538 4:21750254-21750276 AAGCACAAGAGTAGTGATGCTGG + Intronic
971199096 4:24495666-24495688 AAGGAGAATAGAAGGAAGGAAGG + Intergenic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971394356 4:26214781-26214803 AAGAAAAAGAGAAGGAAGGAAGG + Intronic
971397207 4:26239713-26239735 AAGGAGAAGAGAAGAGGGGAGGG + Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971408479 4:26344680-26344702 AAGCAGAAGAGAAAAAAGGAAGG + Intronic
971799130 4:31265957-31265979 ATGTAGGAGAGAAGGGAGGAAGG + Intergenic
972153717 4:36129693-36129715 GAAGAGAAGAGAATTGAGGAAGG - Intronic
972185337 4:36521213-36521235 AAGCAAAAGAGAAATCAGGGAGG - Intergenic
972401814 4:38711722-38711744 AAGCATAAAAGAAATGAAGATGG - Intergenic
972492289 4:39599276-39599298 AAGGAGAAGAGTAGGGTGGAAGG + Intronic
972649067 4:40998733-40998755 AAGCACAAGAGGAGTGACGCTGG - Intronic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973124445 4:46566917-46566939 AAGAAGAAGAGAAGGGAGGAAGG + Intergenic
973312609 4:48725757-48725779 AAGCACAAGAGTAGTGATGCTGG + Intronic
973567608 4:52204026-52204048 AAGGAGGAAAGAAGGGAGGAAGG - Intergenic
974017806 4:56664844-56664866 CAGAAGATGAGTAGTGAGGAAGG + Intronic
974473918 4:62355241-62355263 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
974500807 4:62699389-62699411 CAGCTGAAGAGAAGTGGAGAGGG + Intergenic
974929585 4:68346739-68346761 AAGCACAAGAGTAGTGATGATGG + Intronic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975174952 4:71277522-71277544 AAGAAAAAGAGAAGGAAGGAAGG - Intronic
975288691 4:72650739-72650761 GATCAGAAGACAGGTGAGGAGGG - Intergenic
975372799 4:73607848-73607870 AGGAAGAAGAGTAGAGAGGAGGG - Intronic
975372813 4:73607901-73607923 AGGAAGAAGAGTAGAGAGGAGGG - Intronic
975372832 4:73607969-73607991 AGGAAGAAGAGTAGAGAGGAGGG - Intronic
975411606 4:74058477-74058499 AAGGGGAGGAGAAGTGAGAAGGG - Intergenic
975441569 4:74417240-74417262 AAGGAGCAAAGAAGTGAGGTTGG + Intergenic
975776938 4:77797572-77797594 AAGCACAAGAGTAGTGATGCTGG + Intronic
976010529 4:80482532-80482554 AAGCAGTAGAGAATAGATGAAGG + Intronic
976220626 4:82754212-82754234 AATCAGAAGAGAAAGGAGAAGGG + Intronic
976258619 4:83124814-83124836 AGGCAGAGGAGAGGAGAGGAGGG + Intronic
976263721 4:83170915-83170937 AAGAAGAAGAGATGTGGGGGCGG - Intergenic
976365163 4:84225097-84225119 AAGAAGAAAAGAAGGGAAGAAGG + Intergenic
976565177 4:86544985-86545007 AAGAAGGAAAGAAGAGAGGAAGG + Intronic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976858913 4:89639527-89639549 AAGGAGGAAAGAAGGGAGGAAGG + Intergenic
977607316 4:98995910-98995932 CAGCAGGGGAGAAGCGAGGAGGG - Intronic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
978030854 4:103938780-103938802 GAGGAGAAGAGAGGAGAGGAGGG + Intergenic
978064702 4:104382576-104382598 AAGCACAAGAGCAGTGATGCTGG - Intergenic
978278922 4:106985936-106985958 AAGAAGAAAGGAAGGGAGGAAGG + Intronic
978285185 4:107069186-107069208 AAGAAGATGAGAAGTGAGAAAGG - Intronic
978501789 4:109417734-109417756 AAGCAGGAGAGGAGAGGGGAGGG + Intergenic
978834639 4:113134169-113134191 GAGTAGAAGAGAGGTGAGGTAGG + Intronic
979566157 4:122156307-122156329 AAATAGAAGAGAAATGAGGTTGG + Intronic
979727777 4:123984972-123984994 AAGCAGAAAAGAAGTAAGGAAGG - Intergenic
979756167 4:124342030-124342052 AAAAAGAAGAGAAGGGAAGAAGG - Intergenic
979896393 4:126163248-126163270 AAGAGGAGGAGAAGTGGGGAAGG + Intergenic
980078589 4:128320364-128320386 GAAGAGAAGAGAAGTAAGGAAGG - Intergenic
980121189 4:128730224-128730246 AAGGGGAAGAGAAGGAAGGAGGG - Intergenic
980638074 4:135535869-135535891 GAGGAGAAGAGAGGAGAGGAGGG + Intergenic
981543088 4:145866046-145866068 AAGCAGAAATGAGGTGAGGAAGG + Intronic
981557213 4:146008359-146008381 AAAGGGAAGAGAAGGGAGGAAGG - Intergenic
981622104 4:146712975-146712997 CAGCAGATGAGAGGTTAGGAAGG - Intronic
981635848 4:146878109-146878131 AAGCAGGAATGAAGTGAGGATGG + Intronic
981769357 4:148289771-148289793 AAGGAAAAGAAAAGGGAGGAAGG - Intronic
982274299 4:153623525-153623547 AAGTAGAAGAGGGGTGAGCAGGG - Intronic
982366286 4:154583021-154583043 AAGGAGAGGAGAAGAGAGGGAGG - Intergenic
982890386 4:160841728-160841750 AAGCACAAGAGTAGTGATGCTGG - Intergenic
983121153 4:163886559-163886581 AAGCAGAGAAGAGGAGAGGATGG + Intronic
983552552 4:169032394-169032416 AAGGAGAAAGGAAGGGAGGAAGG - Intergenic
983670737 4:170235002-170235024 AAGCAGAAGTGAAGTGAAGCTGG + Intergenic
983713512 4:170749267-170749289 AAGGAGAAGAGAGGAGACGAGGG - Intergenic
984177258 4:176434781-176434803 AGGAAGAAGGGAAGAGAGGAAGG - Intergenic
984261972 4:177453378-177453400 AAGTAAAAGAGAAGGGAGGAAGG - Intergenic
984411428 4:179403578-179403600 AATCAGAAAAGAAGTGAAAATGG + Intergenic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
984622032 4:181964527-181964549 AGGAAGAACAGAATTGAGGAGGG - Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
986001147 5:3631795-3631817 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
986071201 5:4285398-4285420 TTGCAGAAAAGAAGTAAGGAAGG - Intergenic
986126386 5:4886063-4886085 AAGGCAGAGAGAAGTGAGGATGG + Intergenic
986221872 5:5775596-5775618 AAGTAGAATACAAGGGAGGAGGG + Intergenic
986234561 5:5894920-5894942 AAGGGGAAGAGTAGTCAGGAGGG + Intergenic
986468366 5:8049962-8049984 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
986468443 5:8050296-8050318 AAGGAGAAGGGAAGGAAGGAGGG + Intergenic
986558854 5:9040185-9040207 AAGAAGAAAAGAAGGCAGGAAGG + Exonic
986616487 5:9622730-9622752 AAGCAGAATAGAAGTTACAAGGG - Intergenic
986723987 5:10580825-10580847 AACCAGAAGAGAGGGAAGGATGG - Intronic
987247804 5:16066384-16066406 GAGCAGATGAGAAGACAGGAAGG - Intergenic
987294957 5:16541714-16541736 AAAGAGAAGAGAAGAGAGGGAGG + Intronic
987674924 5:21062531-21062553 TAGCAGGAGAGAATTGAGGAAGG - Intergenic
987954883 5:24726401-24726423 AAGCTGAAGGGAAGGGTGGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988125658 5:27030476-27030498 AAGCAGAAAAGCAGGGGGGATGG + Intronic
988202591 5:28086586-28086608 AAGAAGAGAAGAACTGAGGAGGG + Intergenic
988281606 5:29155637-29155659 AAGCAGAGGAGAAGAGAGAGAGG - Intergenic
988458762 5:31413159-31413181 AAGGAGGAAAGCAGTGAGGATGG + Intronic
989313172 5:40044825-40044847 GAGCAGAGGAGAAGAGAGGGAGG + Intergenic
989525365 5:42447644-42447666 AAGAAGAAAAGAAGGAAGGAAGG - Intronic
989686241 5:44090457-44090479 AAGAAGAAGAATAGTGGGGAGGG - Intergenic
990010177 5:50988189-50988211 AAGTACAAGAGAAGTGTTGAAGG + Intergenic
990201155 5:53376366-53376388 GAGGAGGAGAGAAGAGAGGAGGG + Intergenic
990295462 5:54397587-54397609 AGGCAGAAGAGAAGGAAGGGAGG - Intergenic
990829305 5:59939043-59939065 CAGCAGAAGAGAAGTTAAGAAGG - Intronic
990967514 5:61464989-61465011 AAGCAGCAGTGAACTGAGGTGGG + Intronic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
991172303 5:63642604-63642626 AAGAAGAACAGAAGGAAGGAAGG - Intergenic
991513531 5:67407490-67407512 AAGAAGAAGAGAAGAGAAGAGGG - Intergenic
991715480 5:69447403-69447425 AAGAAGAAAAGAAGGAAGGAAGG + Intergenic
992033687 5:72749676-72749698 AAGCACAAGAGTAGTGATGGTGG + Intergenic
992068985 5:73132358-73132380 AAGAAGAGGAGAAAAGAGGAGGG - Intergenic
992273989 5:75095707-75095729 AAGCAAAAGAGTAGTGATGCTGG + Intronic
992450221 5:76869584-76869606 CAGCAGAATAGACGTGAGAATGG + Intronic
992662143 5:78972283-78972305 GACCAGAAGAGAAGAAAGGAAGG - Intronic
992766242 5:80003353-80003375 AAGAAGAGGAGAAGTAAGTAGGG + Intronic
993015372 5:82529828-82529850 AATCACAAGGGAAATGAGGAAGG - Intergenic
993053362 5:82950917-82950939 AAGGAGAAGAGAAGAGATGGAGG + Intergenic
993196771 5:84758462-84758484 AGGTAAAAGAGAAGTGAGCAGGG - Intergenic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
993349986 5:86838263-86838285 AAGCTCAAGAGAGCTGAGGAAGG - Intergenic
993355690 5:86904423-86904445 ATGGAGAAGAGAGGTGATGAAGG - Intergenic
993454452 5:88111378-88111400 AAACAGAATTGAAGAGAGGAGGG + Intergenic
993811501 5:92484147-92484169 AAGTAGATGAGAAGTTAGCATGG + Intergenic
993861991 5:93147454-93147476 ATCCAGAAGAGAAGTGGGAATGG - Intergenic
993869612 5:93236880-93236902 AAGCAGAAGAGAAGTTAGTGTGG + Intergenic
993869631 5:93237126-93237148 AGGCACAAGAGTAGTGAGGCTGG - Intergenic
993900765 5:93582965-93582987 AAGCAAAAGAGGAGGGGGGAGGG + Intergenic
993963473 5:94331172-94331194 AAGAAGAAGAGAAGAAAGGAAGG + Intronic
994281867 5:97914241-97914263 AAGAAAAAGAGAAGGAAGGAAGG + Intergenic
994285950 5:97967517-97967539 TGGCAGAAGAGAAGTGATAATGG - Intergenic
994719137 5:103360725-103360747 AGGCAGAAGAGAAATGATGGAGG + Intergenic
995062575 5:107827337-107827359 AAGCAGAAAGGAAGGAAGGAAGG + Intergenic
995062589 5:107827532-107827554 AAGCAGAAAGGAAGGAAGGAAGG + Intergenic
995416147 5:111915556-111915578 TAGCAGAAGAGAAGAGGGGAAGG - Intronic
995528053 5:113066594-113066616 AAGCAAAAGTGAAGGAAGGAAGG - Intronic
995558121 5:113351557-113351579 AAGTAGAGGGGAAGTGGGGATGG + Intronic
995590594 5:113695807-113695829 AAGCTGAAGAAAAGTGATAATGG + Intergenic
995919034 5:117288472-117288494 AAGGAAAATAGAAGTTAGGAAGG - Intergenic
995958195 5:117806163-117806185 AAGGAAAAGGGAAGAGAGGAGGG - Intergenic
996087723 5:119321691-119321713 ACCCAGAAGAGAAGTGATGGTGG - Intronic
996852165 5:127965253-127965275 AAACAGAAGAGAGGGGATGAAGG + Intergenic
996868253 5:128154999-128155021 AAGCACAAGAGTAGTGATGCTGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997286548 5:132683218-132683240 AAGCAGAAGAAAAGAGAGGTGGG + Intergenic
997438919 5:133895174-133895196 AAGCCAAAGAGAAGTGAGGGAGG - Intergenic
997672815 5:135690364-135690386 AAGCCAAAGAGAACTGGGGAAGG + Intergenic
997678265 5:135731279-135731301 AATCACAAAAGAAGTGAGAATGG - Intergenic
997917952 5:137947902-137947924 AAGCAAAAGAAAAGTTAAGAGGG + Intronic
998028040 5:138837553-138837575 GAGGAGAAGAGAAGAGAAGACGG - Intronic
998953581 5:147415664-147415686 AAGAAGAAGCTAAGAGAGGAGGG + Intronic
999094524 5:148966135-148966157 AAGCAGAAGACTAGTGAGGCAGG - Intronic
999329140 5:150660879-150660901 AGGCAGGAGAGAAGAAAGGAAGG + Exonic
999727786 5:154451154-154451176 AAGAGGAAGACAAGTGACGATGG + Exonic
999850598 5:155533880-155533902 AAGCAGGAGAGAACAGAGAAGGG - Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999868213 5:155724985-155725007 AAGAAGAAAAGAAATTAGGAAGG - Intergenic
1000250993 5:159495398-159495420 AAGCAGAAGAATAGGGAGGGAGG + Intergenic
1000325001 5:160165428-160165450 CAGCAGAAGAGCAGTGAGGAAGG + Intergenic
1000676579 5:164129529-164129551 AAGCAGGAGAACAGTTAGGAGGG - Intergenic
1000731360 5:164838011-164838033 AACCAGCAGAAAAATGAGGAAGG - Intergenic
1001216761 5:169863753-169863775 AAGCACAAGAGAAGTGGGCAGGG - Intronic
1001278811 5:170371105-170371127 AAGCAGAACAGAAGGGAGACTGG - Intronic
1001334488 5:170785988-170786010 ATGCAAAAGAGCAGGGAGGATGG - Intronic
1001348074 5:170926876-170926898 AAGAAGTAGAGCAGTGAGTATGG - Intronic
1001368178 5:171166170-171166192 AAGAAGGAAAGAAGGGAGGAGGG + Intronic
1001468487 5:171990149-171990171 AAGAGGAAGAGAAGGGAGGGGGG + Intronic
1001654395 5:173338494-173338516 AGGCAGAAGAAAAGCGAGGCGGG + Intergenic
1001655564 5:173346191-173346213 AAGCAGAAGGGGAGTGAAGGGGG + Intergenic
1001667375 5:173444573-173444595 GAGAAGAAGAGACCTGAGGAGGG + Intergenic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1002647792 5:180669747-180669769 AAGCAGAAAGGAAGGGAGGAAGG + Intergenic
1002671737 5:180873082-180873104 AAACAGAAGAGAAGTGGGGATGG - Intergenic
1003004261 6:2366391-2366413 AAGTGGAAGAGAAGAGAGAAAGG + Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003235146 6:4288776-4288798 CAGCAGAAGGGAAGTTGGGAAGG + Intergenic
1003398317 6:5771826-5771848 AAAAAGAAGAGAAGGGAGGAAGG - Intergenic
1003457181 6:6293716-6293738 AAGAAGGAAAGAAGGGAGGAAGG + Intronic
1003559685 6:7170402-7170424 GAGCAGCAGAGAGGTGAGGGAGG + Intronic
1003758991 6:9153488-9153510 CAGAATAAGAGAAGAGAGGAGGG + Intergenic
1003961167 6:11210792-11210814 ATAGAAAAGAGAAGTGAGGAAGG + Intronic
1004066318 6:12248044-12248066 GAGCAGAAGACAAGAGTGGAGGG - Intergenic
1004177742 6:13354798-13354820 AAACAGGAGAGAAGAAAGGATGG - Intergenic
1004341818 6:14814438-14814460 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
1004525817 6:16406765-16406787 AAGCAGAAGAGAACAAAGGAAGG - Intronic
1004569276 6:16829695-16829717 AAGTCTAAGAGAGGTGAGGAAGG - Intergenic
1004586927 6:17011757-17011779 AAGCTGTGGAGAAGTCAGGAAGG - Intergenic
1004622948 6:17347264-17347286 TGGGAGATGAGAAGTGAGGATGG - Intergenic
1004637095 6:17479478-17479500 AAGAAGAGGAGAAGGGAGGACGG + Intronic
1004769138 6:18762175-18762197 AAGCAGGAGAGAAGGCAGGAAGG - Intergenic
1004816739 6:19319277-19319299 AAGAAGAAAAGAAGGAAGGAAGG - Intergenic
1004898087 6:20168687-20168709 AAGAAGAAGAGAGGAGAGGAGGG + Intronic
1005141701 6:22639306-22639328 AAGCAGAAGCAATGTGATGAGGG - Intergenic
1005417094 6:25611589-25611611 GAGAAAAAGAAAAGTGAGGAAGG + Intronic
1005830595 6:29668024-29668046 AAAGAAAAGAGAAGAGAGGAAGG - Intronic
1005882045 6:30069377-30069399 AGGCAGAAGAGAGGGAAGGAGGG - Exonic
1005952375 6:30641548-30641570 AGCAAGTAGAGAAGTGAGGAGGG + Intronic
1006402520 6:33826085-33826107 AAGGAGAGGTGAAGGGAGGAGGG - Intergenic
1006466234 6:34196468-34196490 AAGCGGAAGAGTAGTGCGGCTGG - Intergenic
1006563194 6:34931532-34931554 AAGCAGAAGGGGAGAGAGTAGGG - Intronic
1006609444 6:35285040-35285062 AGGAAGAAGAGAAATGAGAAAGG - Intronic
1007601843 6:43087087-43087109 AGGCAGAACAGTAGTGAAGAGGG - Intronic
1007712228 6:43831758-43831780 AAGGAGTAGAGAAGTGAGGCAGG + Intergenic
1007762069 6:44139033-44139055 AGGCAGAAGTGAAGGAAGGATGG - Intronic
1007888017 6:45255050-45255072 AAGCATAAGAGTAGTGATGCTGG + Intronic
1007968874 6:46030408-46030430 AAGCAAAAGAGCAGTTAGGAAGG - Intronic
1008055535 6:46941881-46941903 AAGCGGAAGAGAAAAAAGGAAGG - Intronic
1008288421 6:49682839-49682861 AGGAAGAAAAGAAGGGAGGAAGG - Intergenic
1008912612 6:56751834-56751856 AAATAAAAGAGAAGAGAGGAGGG + Intronic
1009699097 6:67153134-67153156 AAGCACAAGAGTAGTGATGTGGG - Intergenic
1010413463 6:75587232-75587254 GAGGAGAAGAGAAGAGGGGAGGG - Intergenic
1011058559 6:83234808-83234830 AAGCAGATGATAAGAGATGAAGG - Intronic
1011085588 6:83537135-83537157 AAGAAAAAGAGAAGGAAGGAAGG - Intergenic
1011695750 6:89911269-89911291 AAGAGGAAAAGAAGGGAGGAAGG - Intergenic
1011831380 6:91375825-91375847 ATACAGAAAAGAAGTTAGGAAGG + Intergenic
1012305174 6:97647065-97647087 AAGCAAGAGAGAAGGGAGGAAGG + Intergenic
1012734147 6:102917859-102917881 AAGAAGGAAAGAAGAGAGGAAGG - Intergenic
1012872769 6:104691924-104691946 GAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1012884670 6:104831965-104831987 GAAGAGAAGAGAAGAGAGGAAGG + Intronic
1013187805 6:107776434-107776456 AAGCAGGAAAGAAGGAAGGAAGG + Intronic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1013297617 6:108772191-108772213 AGGCAGAACAGAAATGACGATGG + Intergenic
1013325215 6:109038939-109038961 AAGAAGAAAAGAAGGGAGAAGGG + Intronic
1013657257 6:112258862-112258884 AAGCAGATGAGGAGAGAGCACGG + Intergenic
1014488215 6:122027891-122027913 AGACAGAACAGAAGTGAGCAGGG + Intergenic
1014730273 6:125024229-125024251 AAGCAGAAGAAAAGTCGGGAGGG + Intronic
1014739394 6:125129482-125129504 AGGCAGAAGGGAAGAGAAGAAGG + Intronic
1014778150 6:125533897-125533919 AAGCAGCAGAGAAGCCAAGAAGG - Intergenic
1015036178 6:128657402-128657424 AAGCAGAAGTGAGAGGAGGAAGG + Intergenic
1015484136 6:133749176-133749198 AAGCAGAAGACAACGAAGGATGG + Intergenic
1015885129 6:137910081-137910103 AAGAAGAAAAGAATTGAGGAAGG - Intergenic
1016138197 6:140573458-140573480 AAGTAGAAGAGCAGACAGGAGGG - Intergenic
1016169970 6:141000606-141000628 AATCAAAAGAGAAGTAAGGAGGG - Intergenic
1016231336 6:141808727-141808749 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
1016272804 6:142308669-142308691 GAGCAGAAGAGTTGTGAGGCAGG - Intronic
1016307173 6:142696527-142696549 AGGCAGAAGAGGAGAGTGGAGGG - Intergenic
1016496428 6:144667867-144667889 GTGCAGAAGAGAAGTGAATAGGG - Intronic
1016573991 6:145547168-145547190 AACCAGAATAGAGGTTAGGATGG - Intronic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1016921310 6:149297093-149297115 AAGAAGAAGAGAGGGAAGGAAGG - Intronic
1016977354 6:149822344-149822366 AAAAAAAAGAGAAGTGAGGCTGG + Intronic
1017270392 6:152496811-152496833 AACCAGAAAAGAAGTGAAAATGG + Intronic
1017418118 6:154243507-154243529 AAACAGAAGAGAGGTGAGGCTGG + Intronic
1017575314 6:155795804-155795826 TAGAAGAAGAGAAGTGGGGATGG - Intergenic
1017738877 6:157387186-157387208 AAGAAGAAGGGAAGGAAGGAGGG - Intronic
1017769832 6:157636496-157636518 CAGCAGGAGGGAAGTGAGGATGG - Intronic
1018843982 6:167541499-167541521 ATGAAGAAGAGAAGAGAGAAGGG + Intergenic
1019041157 6:169107345-169107367 AAGAAAAAGAGAAGGAAGGAGGG + Intergenic
1019170969 6:170133048-170133070 AGGCAGATGAGAAGTGGGGCTGG - Intergenic
1019508602 7:1405775-1405797 AAGCTGCAGAGAAATGAGAAAGG - Intergenic
1019908573 7:4083576-4083598 AAGAAGGAAAGAAGGGAGGAGGG - Intronic
1020334683 7:7053682-7053704 CAGCAGAAGAAAAGAAAGGAGGG - Intergenic
1020429302 7:8103399-8103421 AAACAGAAGACAACAGAGGAAGG - Intergenic
1020690291 7:11346671-11346693 GTGAAGAAGAGAAGAGAGGAGGG - Intergenic
1020755281 7:12193082-12193104 AAGCAAGAGAGAAGGGAGCAAGG - Intergenic
1021035515 7:15793784-15793806 AAGGAGAAGAGAAGGTAGAAGGG + Intergenic
1021089859 7:16471002-16471024 AAGCACAAGAGTAGTGATGCTGG - Intronic
1021097322 7:16548366-16548388 AAGAAGGAGAGAAGAGAGAAGGG + Intronic
1021112867 7:16715148-16715170 AAGCAGACAAGAACTGAGGCAGG + Intergenic
1021929792 7:25568890-25568912 AAGTAGAAGAAAAGGCAGGAAGG - Intergenic
1022308889 7:29176250-29176272 ATCCAGAAGAGAAGTCAAGAAGG + Intronic
1022444717 7:30460628-30460650 AAGCAGAGGAGATCGGAGGAGGG + Intronic
1022514638 7:30967669-30967691 AGGCAGAAAAGAAGGAAGGAAGG - Intronic
1022744570 7:33157450-33157472 AGACAGAAGGGAAGTGAGGTGGG - Intronic
1022897052 7:34761098-34761120 AAGCAGGAGGTAAGGGAGGAAGG - Intronic
1022969568 7:35504886-35504908 AAGCAAAAGGGAAGGGAGTAAGG + Intergenic
1023122802 7:36926210-36926232 AAGCAGAGTAGAGATGAGGATGG - Intronic
1023152810 7:37217791-37217813 AAGCAGGAGAGAAGAAGGGATGG + Intronic
1023678780 7:42661352-42661374 AAGCACAAGAGTAGTGATGCTGG - Intergenic
1023724906 7:43132799-43132821 AAGAAGAAAAGAAGGGAGGAAGG - Intronic
1023899176 7:44461852-44461874 AAGCCAAGGAGAAGGGAGGAAGG + Intronic
1024028339 7:45433260-45433282 AAGCAGAGGAGAGAGGAGGAAGG + Intergenic
1024270160 7:47635850-47635872 AAGGAGAAGAGGAGTGAAGGAGG + Intergenic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024439754 7:49403678-49403700 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024561318 7:50647848-50647870 ACTCAAAAGAGGAGTGAGGAAGG + Intronic
1025249540 7:57342773-57342795 AAGCAGAAGAGAATGGCGAATGG - Intergenic
1026078927 7:67199922-67199944 GAGAAGAAGAGAAGAGAGGGAGG + Intronic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026542790 7:71295403-71295425 AAGGGGAAGAGAAGGGAGAAAGG - Intronic
1026662834 7:72317224-72317246 AAAGAGAAGAGAAGGAAGGAAGG + Intronic
1026697893 7:72612017-72612039 GAGAAGAAGAGAAGAGAGGGAGG - Intronic
1026997272 7:74626003-74626025 AAAAAGAAGAGAAAGGAGGAAGG - Intergenic
1027000542 7:74650328-74650350 AAGCACAAGAGTAGTGATGCTGG + Intergenic
1027025544 7:74849561-74849583 AAGCACAAGAGTAGTGATGCTGG - Intronic
1027062220 7:75094558-75094580 AAGCACAAGAGTAGTGATGCTGG + Intronic
1027303946 7:76872525-76872547 ATGCAGATGAGAGATGAGGAAGG + Intergenic
1027342449 7:77223531-77223553 AGGCAGAAGAGCTGTGAGCAAGG + Intronic
1027463932 7:78490946-78490968 AGGAAGAATAGAAGAGAGGATGG + Intronic
1027510960 7:79079130-79079152 AAACAGCTGAGAAATGAGGAGGG - Intronic
1027766925 7:82355779-82355801 TAGAAAAAGAGAAGTAAGGAAGG - Intronic
1028014153 7:85686066-85686088 TAGCAGGAGAGAAGTGGGGGAGG - Intergenic
1028125214 7:87104943-87104965 AAGCTGAAGAGAGGGGAGCAGGG + Intergenic
1028427451 7:90706266-90706288 AAGCAGAAGTAAAGAGAGCAGGG - Intronic
1028559209 7:92155176-92155198 AAGCACAAGAGTAGTGATGCTGG - Intronic
1028878412 7:95850866-95850888 AAGCACAAGAGTAGTGATGCTGG - Intronic
1029162228 7:98560507-98560529 AACCAGGAGAGAAGTGTGGCAGG + Intergenic
1029249166 7:99223760-99223782 AAGCAGGAAAGAAAGGAGGAAGG + Intergenic
1029477697 7:100794843-100794865 GAAGAGAAGAGAAGGGAGGAGGG + Intronic
1029607885 7:101609843-101609865 AAGAAGAAAAGAAGGGAGAAGGG - Intergenic
1029715414 7:102322723-102322745 AAGAGAAAGAGAAGAGAGGAAGG - Intergenic
1030210787 7:106993713-106993735 AAGAAGAAGGGAAGGAAGGAAGG - Intergenic
1030403405 7:109081046-109081068 AGGAAGAAGAGGTGTGAGGAGGG + Intergenic
1030494695 7:110284512-110284534 AAGGAGAAGAGAGGAAAGGAGGG + Intergenic
1030582985 7:111383423-111383445 AAGCAGAGTAGAGATGAGGATGG - Intronic
1030866338 7:114705373-114705395 CAGCAGGAGAGAAGTGAGTGAGG - Intergenic
1031716421 7:125114143-125114165 AGGCAGAAAAGAAGAGAGGAGGG + Intergenic
1031753561 7:125609991-125610013 AAGAAAAAGAGAAGAGAGGAAGG + Intergenic
1031775334 7:125902015-125902037 CAACAGAAGAGAAGTAAAGAAGG + Intergenic
1031969907 7:128056869-128056891 AAGCACAAGAGTAGTGATGCTGG - Intronic
1031988261 7:128177934-128177956 AAGAAAAGGAGAAGTGGGGAGGG + Intergenic
1032685634 7:134231419-134231441 AAGAAGAAAGGAAGGGAGGAAGG - Intronic
1032685745 7:134231787-134231809 AAGAAGTAAAGAAGGGAGGAAGG - Intronic
1032779011 7:135147365-135147387 AAGCAGAAGAGAACCGCTGAAGG + Intronic
1032978627 7:137254766-137254788 AGGCAGAGTAGAAGAGAGGAAGG + Intronic
1033250176 7:139751962-139751984 AAGAAGAAAAGGAGGGAGGAAGG + Intronic
1033298715 7:140165751-140165773 AAGCACAAGAGCAGTGAGGCTGG + Intronic
1033343953 7:140512901-140512923 AAGCAAAAGGCAAGTGAGCAGGG - Intergenic
1033682913 7:143613614-143613636 AAGGAGTAGAGAACAGAGGAGGG - Intergenic
1033701698 7:143844028-143844050 AAGGAGTAGAGAACAGAGGAGGG + Intergenic
1033793517 7:144820241-144820263 AAGCAGAAAAAAAGTATGGAGGG - Intronic
1033958933 7:146888568-146888590 AGGCAGAATAGAAGTGAAAAAGG - Intronic
1034129430 7:148701331-148701353 AGGGAGAAGGGAAGTGAAGAGGG - Intronic
1034336520 7:150327212-150327234 AAGGAGAAGGGAAGTGAAAAGGG + Intronic
1034432629 7:151048761-151048783 AAGGAGAGGAGAAGAGAGGGTGG - Intronic
1034585760 7:152090929-152090951 AATCATAAGGGAAGTGGGGAGGG + Intronic
1034989834 7:155541547-155541569 AAGCAGGCTAGAAGGGAGGAAGG - Intergenic
1035078731 7:156198992-156199014 AAGCTGAAGAGAAGGAAGGAAGG + Intergenic
1035142092 7:156772839-156772861 AAAGAGAAGAGAGGAGAGGAGGG + Intronic
1035332593 7:158106008-158106030 AAACAGAAGAGAGATGGGGATGG - Intronic
1035672554 8:1431493-1431515 AAGAAGAAGAGAAAGGAGAAAGG + Intergenic
1035942965 8:3925075-3925097 AAGAATAAGAGAAGTGGGGCAGG - Intronic
1036126600 8:6068630-6068652 AAGGAGAGGAGAAGGAAGGAAGG - Intergenic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036564070 8:9923262-9923284 AAGCAAAAGAGAGGTCACGATGG - Intergenic
1036663028 8:10720618-10720640 AAGGAAAAGAGAAGAGAGAAAGG + Intergenic
1036983252 8:13495307-13495329 AACCAGATGAGATGTGAAGATGG - Intronic
1037053796 8:14410217-14410239 AGGCAGAAGGAAAGGGAGGAGGG - Intronic
1037135655 8:15456467-15456489 AAGAATAAGAAAAGAGAGGAGGG + Intronic
1037442307 8:18928807-18928829 AGGCAGAAGAGAGGAGAGGAAGG - Intronic
1037543770 8:19897937-19897959 AAGAGGGAGAGGAGTGAGGAAGG - Intergenic
1037644370 8:20777537-20777559 TATCAGAAGAGAAGAGAAGATGG + Intergenic
1037666849 8:20977114-20977136 AAGCAGAGAAGAAGTCAGGGAGG + Intergenic
1037743898 8:21628411-21628433 GAGAAGAAGAGAAGGAAGGAGGG + Intergenic
1037752835 8:21693759-21693781 AAGAAGGAGAGGAGAGAGGAAGG + Intronic
1038038281 8:23704401-23704423 AGACAGGAGAGAAGTGAGAAGGG - Intronic
1038248913 8:25884391-25884413 AAGAAGGAGAGAAGAGGGGATGG + Intronic
1038280850 8:26162979-26163001 AAGCACAAGAGTAGTGATGCTGG + Intergenic
1038537491 8:28364021-28364043 AAGCAGAAGAGAAAGAAGGAAGG + Intronic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1038644698 8:29351876-29351898 ATGCAAAAGAGAAATGGGGATGG - Intergenic
1038704388 8:29880293-29880315 AAGCTGAAGAGAGGAGAGCAAGG + Intergenic
1038905389 8:31896510-31896532 AGGCAGATGAGAATTGAGAATGG - Intronic
1039138764 8:34358498-34358520 AATCAGAACAGAAATGATGAAGG - Intergenic
1039181100 8:34867391-34867413 AATCAGAAGAGAGGTAAGTAGGG + Intergenic
1039397670 8:37240940-37240962 AAGCAGGAGGGAAGGGAGGAGGG + Intergenic
1039573620 8:38606040-38606062 AAGAAAAGGAGAAGTTAGGAGGG - Intergenic
1040441877 8:47451781-47451803 AAGGAGAAGAGAAGAGAGGGAGG + Intronic
1040445969 8:47493995-47494017 AAGGAGAAAAGAAGGAAGGAGGG - Intronic
1040675873 8:49749587-49749609 AAGGAGCAAAGAAGTGAGGGAGG + Intergenic
1041164528 8:55078206-55078228 AAGCAAAAGAGTAGTGAGGCTGG - Intergenic
1041254160 8:55965066-55965088 AAGCAGAAGAGAGGACAGGAAGG + Intronic
1041554419 8:59136703-59136725 AAAAAGAAAAGAAATGAGGAGGG + Intergenic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1042093909 8:65190855-65190877 AAGCAGGTGAGAAGAAAGGAAGG + Intergenic
1042834312 8:73064310-73064332 CAGCAGATGAGAAGTGAGGTGGG - Intergenic
1042950786 8:74198894-74198916 AGCCAGAAGGGAGGTGAGGATGG + Intergenic
1043770171 8:84187969-84187991 AAGTAGAAGAGAAGTGAAGTGGG + Intronic
1043826125 8:84930753-84930775 AGGAAGGAGAGAAGGGAGGAAGG + Intergenic
1043832924 8:85011946-85011968 AAAGAGAAGAAAAGGGAGGAGGG - Intergenic
1044505549 8:93013455-93013477 ATGCAGAAGAGAGGTTGGGAGGG + Intronic
1044627105 8:94244790-94244812 AAGCAAAGGAGTAGTGAGTAAGG - Intergenic
1044719499 8:95132352-95132374 AAGTACATGGGAAGTGAGGAGGG + Intergenic
1044729769 8:95220453-95220475 AAACAGAAGTGCATTGAGGATGG - Intergenic
1044756046 8:95462037-95462059 AAGCAAAAAGGAAGAGAGGAAGG - Intergenic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1044875684 8:96663859-96663881 AAACATAAAGGAAGTGAGGAAGG + Intronic
1044951511 8:97439920-97439942 AAGCACAAGAGCAGTGATGTTGG - Intergenic
1045151988 8:99418270-99418292 AAGAAGAAAAGAAGAAAGGAGGG - Intronic
1045366053 8:101477319-101477341 CAGCAGAAGACAAGTGAAGGAGG - Intergenic
1045490198 8:102662433-102662455 AAAAAGAAGAGAACTGAGGGTGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045817348 8:106292209-106292231 AAGCACAAGAGTAGTGATGCTGG + Intronic
1046126094 8:109910281-109910303 AAGGAGAGGAGAGGAGAGGAGGG - Intergenic
1046236281 8:111427958-111427980 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
1046260054 8:111756532-111756554 AAGCACGAGAGAAAAGAGGATGG + Intergenic
1046555556 8:115768691-115768713 AAGAAGAAGGGAAGGGAAGAAGG - Intronic
1046952663 8:120032991-120033013 CAGTAAAAGAGAAGTGAGGATGG + Intronic
1047061141 8:121227501-121227523 CAGAAGAATGGAAGTGAGGATGG - Intergenic
1047061790 8:121235588-121235610 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1047120885 8:121903303-121903325 AAGCAGAAGATCATTGAGGATGG + Intergenic
1047435314 8:124831083-124831105 AGACAGAAAAGAAGTGGGGAGGG + Intergenic
1047511616 8:125520280-125520302 GAGGAGAAGAGAAGAGAGGGAGG + Intergenic
1047767766 8:128003274-128003296 GAGGAGAGGAGAAGAGAGGAAGG - Intergenic
1047857724 8:128930558-128930580 AAGAAGAAAAGAAGGGAGGCAGG - Intergenic
1048086367 8:131185257-131185279 AAGCAAAAGAGAAGTAGGGGAGG - Intergenic
1048127189 8:131648934-131648956 AAGCTGAAAGGAAGTGAAGATGG - Intergenic
1048195912 8:132331567-132331589 AATCAGAAGAGAAGAGGGGAGGG - Intronic
1048366412 8:133742589-133742611 AAGGAGAAAAGAAGGGAGGAAGG + Intergenic
1048607460 8:135984562-135984584 AAGAATAATAGATGTGAGGAAGG + Intergenic
1048754797 8:137727159-137727181 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
1048894683 8:138980794-138980816 AAGCACAAGAGAGGGGAGGGTGG + Intergenic
1048974968 8:139666139-139666161 AAGCAGGAGAGAACTGAGAGGGG + Intronic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1050306222 9:4308390-4308412 AAGAAGAGGAGAAGGAAGGAAGG + Intronic
1050366380 9:4877323-4877345 AAGCATATCAGAATTGAGGAGGG - Intronic
1050416847 9:5427325-5427347 AAGTAGAAGAGTAGTGATGCTGG + Intronic
1050751099 9:8938279-8938301 GAGGAGATGAGAAGAGAGGAGGG + Intronic
1050899178 9:10923566-10923588 AAGCAGAAGAAATATGAGAAAGG - Intergenic
1051069701 9:13150591-13150613 AAGCAATGGAGAAGTGATGAGGG - Exonic
1051257045 9:15224471-15224493 AAAGAGAAGAGAATGGAGGAAGG - Intronic
1051586627 9:18733672-18733694 AAAGAGAAGAGAAGTGGGGTGGG - Intronic
1051738145 9:20224651-20224673 AGGGAGAAGAGAAGAGGGGAGGG + Intergenic
1051794595 9:20851387-20851409 AAGTGGAAGAGCAGTGCGGAAGG + Intronic
1052045435 9:23788685-23788707 AAGCACAAGAGTAGTGATGCTGG - Intronic
1052433979 9:28402598-28402620 AAGAGGAAAAGAAGAGAGGAAGG - Intronic
1052976309 9:34413145-34413167 AAACAGAAGGGAGGTAAGGAAGG + Intronic
1053141339 9:35684701-35684723 GAGCAGAGGGGCAGTGAGGATGG - Intronic
1053946404 9:43313127-43313149 AAGCGGAAAAGAAGAAAGGAAGG + Intergenic
1054791930 9:69264697-69264719 AAGCAGCAAAGAGGTGAGCAAGG - Intergenic
1054863467 9:69976202-69976224 AAGACACAGAGAAGTGAGGAGGG + Intergenic
1055024969 9:71709798-71709820 AAGCAGAAGAGTTGTGGGAAGGG + Intronic
1055074439 9:72198981-72199003 AAGCTGAAAAGAAGGGAGAAAGG + Intronic
1055263692 9:74471159-74471181 AGGAAGAAGAGGAGTGATGAAGG + Intergenic
1055603080 9:77940140-77940162 AAGCTGAAGAGAAGTTATAAAGG + Intronic
1055628272 9:78196359-78196381 AAGAAAATAAGAAGTGAGGATGG - Intergenic
1055797536 9:79991481-79991503 ATGCAGAATAGAGGTTAGGAAGG + Intergenic
1055946550 9:81696392-81696414 AGACAGGAGAGAAGTGGGGAAGG + Intergenic
1055956634 9:81780050-81780072 AAACAGAAGACAGGTGAGCATGG + Intergenic
1056193118 9:84204386-84204408 GAAGAGAAGAGAAGAGAGGAAGG + Intergenic
1056268684 9:84925181-84925203 AAGAAGAAGAGAAGAGAAGAAGG - Intronic
1056455923 9:86760062-86760084 AAGCACAAGAGTAGTGATGCTGG - Intergenic
1056456301 9:86764260-86764282 AAGAAAAAGAGAACTGAGAACGG + Intergenic
1056523180 9:87418861-87418883 AGGGAGAAGAGAACTGAGCAAGG - Intergenic
1056533887 9:87511119-87511141 AGGCAGAGGAGAAGAGAGGGAGG - Intronic
1056617038 9:88177650-88177672 AGCCAGAAGGGAAGTTAGGAGGG + Intergenic
1056685411 9:88754923-88754945 AAGCAGGAGTAATGTGAGGATGG - Intergenic
1057114291 9:92505964-92505986 AAGCAAGAGAGAAGAGAGGGAGG + Intronic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057447141 9:95124546-95124568 AACTAGAAGGGGAGTGAGGAAGG - Intronic
1057466963 9:95323157-95323179 AAGCAGGAGAGAGGGGAAGAGGG - Intergenic
1057635942 9:96767029-96767051 AATCAAAAGAGAAATGAGGCTGG + Intronic
1057748583 9:97771963-97771985 GAGCAGCAGAGAAGCGAGGGAGG + Intergenic
1057909427 9:99006095-99006117 AAGGAGGAGAGAAGGGAGAAAGG - Intronic
1057976964 9:99615722-99615744 AAGAAGAAAAGAAGGAAGGAAGG + Intergenic
1058021058 9:100089253-100089275 AAGCACAAGAGTAGTGATGCTGG + Intronic
1058147625 9:101429722-101429744 AAGCAGAAGTGAGGTGTGAATGG + Intronic
1058356473 9:104089520-104089542 AAGCAGATGAGAGGTGAGCTAGG + Intergenic
1058577804 9:106422224-106422246 TAGCAGAAGGGAAGGGAGAAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058860466 9:109113125-109113147 AAGCAGAACAGAAGTTTGTATGG - Intronic
1058901707 9:109447827-109447849 AGGCAGAAGAGAACTGTTGAAGG - Intronic
1058984731 9:110200169-110200191 AAGAAGGAAAGAAGGGAGGAAGG + Exonic
1059130537 9:111743603-111743625 AAGCACAAGAGTAATGAGGATGG + Intronic
1059354222 9:113687045-113687067 AAGGAAGAGAGAAGGGAGGAGGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059635933 9:116170709-116170731 TAGCAGAAAAGAAGGGTGGATGG - Intronic
1059672251 9:116502811-116502833 AAGAAGAAGAGAATGAAGGAGGG + Intronic
1059760217 9:117330456-117330478 GAGCAGAAGAGAATAGAGGACGG + Intronic
1059841135 9:118217856-118217878 AAGAAGGAGAGAAGAAAGGAAGG + Intergenic
1059948498 9:119437768-119437790 AGGCAGAAGAAAACTAAGGATGG - Intergenic
1060174240 9:121485779-121485801 AAGAAGGAGGGAAGTGGGGAAGG + Intergenic
1060731390 9:126039236-126039258 AGGCCAAAGAGAAGTAAGGAGGG - Intergenic
1060738352 9:126080866-126080888 AAGCAGGAGTGAAGTGATGCTGG + Intergenic
1060864315 9:126982887-126982909 AAGAAGAAAAGAAGAGAAGAAGG - Intronic
1061013948 9:127971349-127971371 AAGCAGAATGGAAAGGAGGAGGG - Intronic
1061069755 9:128301990-128302012 GAGCAGAGGAGAAGTTAAGAGGG + Intergenic
1061477168 9:130875816-130875838 AAGGAGAAGAGAGGAGGGGAGGG - Intronic
1061591981 9:131603619-131603641 CACCAGAAGATAAGGGAGGAAGG + Intronic
1061879507 9:133561731-133561753 CAGCAGGGGAGAAGTTAGGAGGG + Intronic
1062085579 9:134646360-134646382 AAGGAGAAGAGAAGGAGGGAAGG - Intronic
1062265189 9:135683663-135683685 TAGCAGAAGAGGAGAGAGGCAGG - Intergenic
1062306764 9:135911771-135911793 CAGCAGAAGAGAAGGCAGCAGGG + Intergenic
1062608501 9:137360443-137360465 AAGAAGAAGAAAAGGAAGGAAGG - Intronic
1203760438 EBV:10463-10485 AACGGGAAGAGAAGTGGGGAGGG + Intergenic
1203589534 Un_KI270747v1:41685-41707 AAGCGGAAAAGAAGAAAGGAAGG + Intergenic
1185515683 X:697315-697337 AACCAGAAAAGAAGTGAAAATGG - Intergenic
1185668080 X:1784027-1784049 CAAAAGAAGAAAAGTGAGGAAGG + Intergenic
1186020075 X:5245179-5245201 AAGAAGAAGTGAAGTGAAGAAGG - Intergenic
1186064114 X:5743001-5743023 AAGAAGAAGAAAAGGAAGGAAGG + Intergenic
1186072103 X:5833206-5833228 AAGCAGAAGGGAAGAGAGGTAGG - Intergenic
1186077645 X:5898188-5898210 AAGAAGAAGGGAAGGAAGGAGGG - Intronic
1186077969 X:5901033-5901055 ACCCAGAGGAGAAGAGAGGAGGG - Intronic
1186181743 X:6980189-6980211 AAAGAGAAGAGAAGAGAAGAAGG - Intergenic
1186303446 X:8227238-8227260 AAGAGGAAGAGAAGGAAGGAAGG - Intergenic
1186578033 X:10787553-10787575 GAAGAGAAGAGAAGAGAGGAGGG - Intronic
1186749464 X:12606777-12606799 AAGAAGAAAAGAAGGGAGGGAGG - Intronic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1187040771 X:15593377-15593399 AGGAAGAAGAGAAGAAAGGAAGG + Intronic
1187270335 X:17774990-17775012 GAGCAGAAGAGGTGTGAGGATGG - Intergenic
1187295688 X:17998497-17998519 AAGGAGGAGAGAAGTTAGGTGGG - Intergenic
1187320173 X:18230718-18230740 GAGCAGAAGAGGTGTGAGGATGG + Intergenic
1187725671 X:22199691-22199713 AAGCATAAGAGTAGTGATGCTGG + Intronic
1188000463 X:24975535-24975557 AAGCAGATGAGAAATCAGGCTGG - Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188352018 X:29143689-29143711 CAGCACAAGAGTAGTGATGATGG + Intronic
1188360222 X:29243926-29243948 GAGCACAAGAGAAGAGGGGAGGG - Intronic
1188555206 X:31404034-31404056 AAGGAGGAAAGAAGTGAAGAAGG - Intronic
1189000333 X:36937369-36937391 AAGGAGAGGAGAGGAGAGGAGGG + Intergenic
1189293672 X:39903893-39903915 AAGCAAAGGAGAAGAGGGGAAGG - Intergenic
1189314152 X:40041920-40041942 AAGGAGAGGAGAAGGAAGGAGGG + Intergenic
1189686267 X:43566785-43566807 AAGAGGAAGAGAAGGAAGGAAGG + Intergenic
1190116779 X:47630429-47630451 CAGCACAAGGGAAGTGAGAAAGG + Intergenic
1190431766 X:50384850-50384872 AAGCAAAAAAGAAAGGAGGAAGG + Intronic
1190451209 X:50582496-50582518 AGGCAAAAGTGAAGTGAAGAAGG - Intergenic
1190520815 X:51277821-51277843 AGGCAGAAGGGAAAAGAGGAGGG + Intergenic
1190841333 X:54147353-54147375 AAGTAGAAGTGAGGTGACGAAGG + Intronic
1190962430 X:55265847-55265869 GTGCTGAAGAGAAGTGAGTAGGG - Intronic
1191122723 X:56922737-56922759 CAGCAGAAGAGAGGTGGGGGAGG - Intergenic
1191661547 X:63656804-63656826 AAGCAGAAGAGAGGGTGGGAAGG + Intronic
1191720024 X:64221700-64221722 TAGCAGGAGAGAAGAAAGGAGGG + Intergenic
1191846936 X:65553911-65553933 AGGCAGAAGAGAACAAAGGAAGG - Intergenic
1192234174 X:69285602-69285624 AAGCAGAAGAGAATGGAGAAGGG + Intergenic
1192319442 X:70077706-70077728 AGGCAGAAGAGAACAAAGGAAGG + Intergenic
1193056350 X:77155434-77155456 AAAAAGAAAAGAAGGGAGGAAGG + Intergenic
1193083890 X:77431011-77431033 GAAGAGAAGAGAAGTGAGGCAGG - Intergenic
1193084247 X:77434684-77434706 AAGCACAAGAGCAGTGATGCTGG - Intergenic
1193097445 X:77566069-77566091 AAGAAGAGGAGAAGGAAGGAGGG + Intronic
1194587940 X:95759723-95759745 AAGCTGTACAGAAGTGAAGAGGG - Intergenic
1194589531 X:95781814-95781836 AATCAGAAGAGTAGTGATGCTGG + Intergenic
1194937292 X:99966122-99966144 AACTAAAAGAAAAGTGAGGATGG - Intergenic
1195129146 X:101837660-101837682 GAGAAGAAGAGAAGCAAGGAAGG + Intronic
1195892719 X:109713005-109713027 AAGGAGGAGAGAAGAGAGAAGGG + Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196016030 X:110941426-110941448 AACAAGAATAGAAGTGAGGAAGG - Intergenic
1196574610 X:117303302-117303324 GAACAGAAGAGAATAGAGGAGGG + Intergenic
1196943664 X:120802514-120802536 AAGGAGAAAAGAAGAGAGGAAGG + Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1197336662 X:125217187-125217209 AAGCACAAGAGGAGTGATGCTGG - Intergenic
1197859115 X:130950547-130950569 CAGAAGAAGAGAAGAAAGGAGGG - Intergenic
1198036285 X:132804470-132804492 CAGGAGAAGAGCAGTGAGTATGG - Intronic
1198041713 X:132859584-132859606 AAGAAGAAAAGAAAAGAGGAGGG + Intronic
1198294482 X:135272665-135272687 AAGCACTAGAGAAGTGAGGCAGG + Intronic
1198327199 X:135585474-135585496 GAGAAGAGGAGAAGGGAGGAAGG + Intergenic
1198411946 X:136379528-136379550 AAGGAGAGGAGAAGAGAGGGAGG - Intronic
1198487130 X:137098755-137098777 AAGAAAAAGAGAAGTCGGGAAGG - Intergenic
1198988751 X:142486304-142486326 AAGCAAAAGAGAAGAGAGGGAGG + Intergenic
1199101082 X:143801317-143801339 ATGCAGAAGAAAAGAGAAGAAGG + Intergenic
1199389100 X:147259246-147259268 AAGCAGGAGAGAATTTTGGAAGG + Intergenic
1199483044 X:148319085-148319107 AAGCACAAGAGTAGTGATGCTGG + Intergenic
1199741640 X:150741257-150741279 AAGAAGATGAGAGGTGAGGCTGG - Intronic
1199745891 X:150771768-150771790 AAGCAAAAGGAAAGTGAGGAAGG + Intronic
1199848564 X:151709034-151709056 AAGAATAAGAGAAGTCAGGGAGG + Intergenic
1200082592 X:153585879-153585901 AAAGAGAAAAGAAGTGGGGAGGG + Intergenic
1200825904 Y:7640353-7640375 AAGAAGAAGGGAAGGAAGGAAGG - Intergenic
1200957047 Y:8960136-8960158 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
1201051429 Y:9939926-9939948 AAGAAGAAAAGAAGGAAGGAAGG + Intergenic
1201131058 Y:10952310-10952332 AAGGAGAAGAGAGGAGTGGAAGG - Intergenic
1201461481 Y:14230367-14230389 AAGAAAAAGAGAAGGAAGGAAGG + Intergenic
1201462803 Y:14245978-14246000 AAGCAGAAAAGAAATAAGAAAGG + Intergenic
1201550124 Y:15210478-15210500 AGGAAGAAAAGAAGGGAGGAAGG + Intergenic
1201578601 Y:15487766-15487788 AAGAAGAAAGGAAGAGAGGAAGG - Intergenic
1201767319 Y:17583892-17583914 AAGCAGAAGAGCAAAGATGAGGG - Intergenic
1201834234 Y:18322093-18322115 AAGCAGAAGAGCAAAGATGAGGG + Intergenic
1202242316 Y:22783949-22783971 AAGAAGAAAAGAAGGAAGGAAGG - Intergenic
1202395302 Y:24417697-24417719 AAGAAGAAAAGAAGGAAGGAAGG - Intergenic
1202475483 Y:25252397-25252419 AAGAAGAAAAGAAGGAAGGAAGG + Intergenic