ID: 1085754744

View in Genome Browser
Species Human (GRCh38)
Location 11:79193110-79193132
Sequence CCTCAAATACTGAAAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 480}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085754744_1085754748 5 Left 1085754744 11:79193110-79193132 CCATTTTCTTTCAGTATTTGAGG 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085754748 11:79193138-79193160 AAAGAAGGCTTCATAATGATGGG 0: 1
1: 0
2: 0
3: 26
4: 243
1085754744_1085754747 4 Left 1085754744 11:79193110-79193132 CCATTTTCTTTCAGTATTTGAGG 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085754747 11:79193137-79193159 AAAAGAAGGCTTCATAATGATGG 0: 1
1: 0
2: 1
3: 38
4: 535
1085754744_1085754749 17 Left 1085754744 11:79193110-79193132 CCATTTTCTTTCAGTATTTGAGG 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085754749 11:79193150-79193172 ATAATGATGGGTACCATTTCTGG 0: 1
1: 0
2: 2
3: 14
4: 157
1085754744_1085754746 -10 Left 1085754744 11:79193110-79193132 CCATTTTCTTTCAGTATTTGAGG 0: 1
1: 0
2: 2
3: 52
4: 480
Right 1085754746 11:79193123-79193145 GTATTTGAGGACTGAAAAGAAGG 0: 1
1: 0
2: 2
3: 38
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085754744 Original CRISPR CCTCAAATACTGAAAGAAAA TGG (reversed) Intronic
900001019 1:14893-14915 ACTTAAATACAGGAAGAAAAAGG + Intergenic
900016865 1:157431-157453 CCACTAATACTACAAGAAAATGG - Intergenic
900020734 1:185414-185436 ACTTAAATACAGGAAGAAAAAGG + Intergenic
900047125 1:516023-516045 CCACTAATACTACAAGAAAATGG - Intergenic
900069344 1:757880-757902 CCACTAATACTACAAGAAAATGG - Intergenic
901254576 1:7811477-7811499 CCTCCAAAACTGTAAGAAATAGG - Intronic
902275006 1:15333212-15333234 CCCAAAAGACTAAAAGAAAAGGG + Intronic
902318291 1:15640730-15640752 CCAGAAATAATGAAGGAAAAGGG - Intronic
902416100 1:16240427-16240449 TCTCAAAAAATAAAAGAAAAAGG - Intergenic
903193938 1:21671194-21671216 GCTCAAACACTGTAATAAAAAGG + Intergenic
904732026 1:32600707-32600729 CCTCCAATATTAAAAGAAAAAGG - Exonic
905951056 1:41951150-41951172 AATTAAATACTGAAAGAAGAAGG + Intronic
905965401 1:42089903-42089925 CAACAAATACTAAAAGAGAAGGG - Intergenic
906394623 1:45451294-45451316 CCTCAAACACAGCATGAAAAGGG - Intronic
906862489 1:49376506-49376528 CCCCAAATACTGAAGGGATAAGG - Intronic
907407906 1:54265051-54265073 TCCCAAATACCGACAGAAAATGG + Intronic
908540769 1:65120070-65120092 CCCCAAGGACTGAAAAAAAAAGG - Intergenic
909375047 1:74930863-74930885 CAACAAAAACAGAAAGAAAAAGG + Intergenic
909831637 1:80198711-80198733 AGTCAAATATTGAAAAAAAATGG - Intergenic
910723496 1:90313777-90313799 CCTCAAACCCTGAGAGGAAAAGG + Intergenic
911246161 1:95520203-95520225 ACTGGAATACTGAAATAAAAAGG + Intergenic
914373934 1:147055484-147055506 CCTCAAATGTAAAAAGAAAATGG + Intergenic
914675944 1:149907615-149907637 CCTAAGATAGTGAATGAAAAAGG + Intronic
915670045 1:157481032-157481054 TTTAAAATTCTGAAAGAAAAAGG + Intergenic
915804662 1:158832399-158832421 TCTCAGTTACTGAAAGAACAAGG - Intronic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916665790 1:166966138-166966160 CCTAAAAAACTAAAATAAAAAGG + Intronic
917406993 1:174717836-174717858 AGTCCAATACTAAAAGAAAAAGG + Intronic
917919642 1:179740528-179740550 CATGAAATACTACAAGAAAAAGG + Intergenic
918437447 1:184530850-184530872 CCCCAAATACCAGAAGAAAAGGG - Intronic
918742945 1:188159667-188159689 CCACAAATACTGTAAAAATACGG + Intergenic
918819037 1:189226718-189226740 CAATAAATACTGAAAAAAAAAGG + Intergenic
918825255 1:189315719-189315741 CATCAAATACTGAAAAAGAGTGG - Intergenic
919990458 1:202705522-202705544 CCTCCAAATCTGAAAGAAAGGGG - Intronic
921341509 1:214138886-214138908 CCTCAGAAACTGAAAGACATTGG + Intergenic
921471389 1:215554781-215554803 ACACATAGACTGAAAGAAAAGGG - Intergenic
921662575 1:217822883-217822905 CATCATATATTTAAAGAAAAAGG - Intronic
922104708 1:222503279-222503301 CCACTAATACTACAAGAAAATGG - Intergenic
922195955 1:223360897-223360919 TCTCAATTACTGAATGCAAATGG - Intronic
922265020 1:223975793-223975815 CCACTAATACTACAAGAAAATGG - Intergenic
922945588 1:229511100-229511122 CCTGAAAGACTAAAAGTAAAGGG + Intergenic
923216939 1:231857046-231857068 CCCAAAACACTGAAAGAAACTGG - Intronic
923885850 1:238154657-238154679 CCTAAAATAATGAAATTAAAAGG + Intergenic
924346881 1:243080803-243080825 CCACTAATACTACAAGAAAATGG - Intergenic
924949477 1:248868894-248868916 ACACATATACTGAAAGTAAAGGG + Intergenic
1063301450 10:4852794-4852816 CCTCTAAAACTGTGAGAAAATGG - Intergenic
1065015249 10:21456926-21456948 CCTCAAACAATAAAAGAAAGTGG - Intergenic
1066072143 10:31828313-31828335 ACTCATCTATTGAAAGAAAAAGG - Intronic
1066371460 10:34821494-34821516 TCTCAAATCCTGAAAGAATCTGG + Intergenic
1066579117 10:36860678-36860700 CCCAAAATATTGAAATAAAATGG - Intergenic
1066609009 10:37215618-37215640 CCTGAAAAACAGAAAAAAAATGG - Intronic
1066729467 10:38424050-38424072 CCACTAATACTACAAGAAAATGG + Intergenic
1068067854 10:52154650-52154672 CCAAAAATATTGAAATAAAAAGG - Intronic
1069094835 10:64247130-64247152 CCTCAAAAACTGAAAAAAAATGG + Intergenic
1069156038 10:65032399-65032421 CCTCAAAAAGTCAAACAAAAAGG + Intergenic
1069161066 10:65092993-65093015 CCTCAAAAACTTAGACAAAAGGG + Intergenic
1070335542 10:75452070-75452092 CCTTGGGTACTGAAAGAAAAAGG - Intronic
1070533087 10:77354431-77354453 CCTCAAATGGTGAAAAAAAGGGG - Intronic
1070656457 10:78275046-78275068 CCACAAACACTGAATGGAAAAGG - Intergenic
1070686616 10:78489470-78489492 GCTGAAATAAGGAAAGAAAATGG - Intergenic
1071260460 10:83914741-83914763 CAGCAAATACTCAAAGAAATGGG - Intergenic
1073552935 10:104420030-104420052 CCTCAGAAAGTGTAAGAAAAAGG + Intronic
1073599362 10:104831678-104831700 CCCAAAACACTGAAAGAAAGAGG - Intronic
1074823780 10:117200452-117200474 TCTCAAGTACTAAAAGCAAAAGG - Intronic
1076437738 10:130458050-130458072 CCTAAGATACTGAATTAAAATGG + Intergenic
1076940928 10:133607902-133607924 ACTCAAATACAAAAACAAAAAGG + Intergenic
1076973470 11:152646-152668 CCACTAATACTACAAGAAAATGG - Intergenic
1077853074 11:6094549-6094571 GCACAAATCCTGAAAGAGAAAGG - Intergenic
1077904159 11:6516110-6516132 TCTCAGAAACTGAAAGACAATGG - Intronic
1078734065 11:14003456-14003478 CCTAAAACACTGAAAGAAACTGG - Intronic
1079439167 11:20492674-20492696 GTTCCAATAGTGAAAGAAAATGG + Intronic
1079845015 11:25454501-25454523 CTTCAGATATTGGAAGAAAATGG - Intergenic
1080636499 11:34128634-34128656 CTGAAAATACTGAAATAAAATGG + Intronic
1080895166 11:36442824-36442846 ACTAAAATACTGATAGAAATAGG - Intronic
1080912417 11:36615903-36615925 TCTAAACTGCTGAAAGAAAAAGG + Intronic
1081006653 11:37752850-37752872 TCTCAAAAAATGAAAGAAGAAGG - Intergenic
1081685046 11:45036480-45036502 CTGCAAATACTAAAAGATAATGG - Intergenic
1082712616 11:56571693-56571715 CTTCAAACACTGAACAAAAAAGG - Intergenic
1082875309 11:57981901-57981923 CCTCAAAAACTGAGAGAAGGTGG + Intergenic
1083120431 11:60507115-60507137 CCCTAAATAGTAAAAGAAAAAGG + Exonic
1083421118 11:62553821-62553843 CCTCAAATGCTGAGGGATAAGGG - Intronic
1085117390 11:73941798-73941820 ACTCAAATACAAAAACAAAAAGG - Intergenic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1087326652 11:96732105-96732127 TTTCAAATAATGAAAGAGAATGG - Intergenic
1087478159 11:98664212-98664234 TCAGAAATACTGAAAAAAAAGGG - Intergenic
1087482701 11:98721127-98721149 AATCAAATAGTGAACGAAAAAGG + Intergenic
1087688401 11:101291097-101291119 CTCCATATACTGTAAGAAAAGGG - Intergenic
1087740537 11:101882226-101882248 CTTCAAATCCTGAAAAAAGAAGG + Intergenic
1088067594 11:105739727-105739749 CATCAAATAATTACAGAAAAAGG + Intronic
1088148938 11:106720523-106720545 TCTCTAATAATGAAAAAAAAGGG - Intronic
1088457128 11:110044503-110044525 CCCAAAACACTGAAAGAAACTGG + Intergenic
1089764616 11:120753705-120753727 CCTCTAATTTTGAAAGACAAGGG - Intronic
1091207254 11:133830348-133830370 CCTTATAAAATGAAAGAAAAGGG - Intergenic
1091293004 11:134452571-134452593 CCACAAATGCTGATAGACAAAGG - Intergenic
1091374107 12:15008-15030 ACTTAAATACAGGAAGAAAAAGG + Intergenic
1091734174 12:2905748-2905770 CCTCAAATAGTGAAAAAAACAGG - Intronic
1093564595 12:20587867-20587889 CCTGACATACAGATAGAAAAAGG + Intronic
1093634567 12:21449531-21449553 CATCAAACAATGAAAGAAAAGGG - Intronic
1095202142 12:39396521-39396543 CCTCAGATAATGAATTAAAATGG + Intronic
1095333165 12:40993035-40993057 CCTGAAATAGTAAAATAAAAAGG + Intronic
1095389037 12:41683566-41683588 CCCCAAATACTGTAAAAAAAGGG - Intergenic
1096222268 12:49838408-49838430 CCTGAATCACTGATAGAAAAAGG - Exonic
1097002164 12:55886201-55886223 CCTCAAACACTAAAATACAAAGG - Intergenic
1097366317 12:58717629-58717651 CCTCAAAAACTGAAGCAAACTGG + Intronic
1098049599 12:66439444-66439466 CCTGATAGACTGAGAGAAAAGGG - Intronic
1098213423 12:68190168-68190190 CCTCATCTACTGAAAAAACATGG - Intergenic
1098779956 12:74674438-74674460 AAGCAAATACTGAAATAAAAAGG + Intergenic
1098850888 12:75594555-75594577 CTTCAAAAACTGAACGGAAATGG + Intergenic
1098861622 12:75717206-75717228 CCTCAATTATTGAATAAAAATGG + Intergenic
1099279227 12:80622621-80622643 ACTTAAATACTGAAAGAATCTGG - Intronic
1099333193 12:81318162-81318184 CCTCAAAGACTGGTAGAAATAGG - Intronic
1099444253 12:82733398-82733420 CCCTAAATACTGCAAGAAAAAGG - Intronic
1100451633 12:94712405-94712427 TCTCAAAAAAAGAAAGAAAAAGG - Intergenic
1100544920 12:95592604-95592626 ACACAAATACTCAAGGAAAAAGG + Intergenic
1101532655 12:105588134-105588156 CCTCAAATCATGGAAGTAAAAGG - Intergenic
1102664716 12:114562218-114562240 CCCAAAATACTGAGATAAAATGG + Intergenic
1104491417 12:129196683-129196705 CATCAAAAAATGAGAGAAAATGG - Intronic
1104732814 12:131117751-131117773 GCTCAAATACTGTAAGAATGTGG + Intronic
1106037093 13:26052582-26052604 ACCCAAATATAGAAAGAAAAAGG - Intergenic
1106531568 13:30597886-30597908 CTTGGAATGCTGAAAGAAAAAGG - Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1106908398 13:34434478-34434500 GCTCAAATAATAATAGAAAAGGG + Intergenic
1106976943 13:35229781-35229803 ATTTAAATTCTGAAAGAAAATGG - Intronic
1107347982 13:39483598-39483620 CATCAAAAAATGAAAGGAAAAGG - Intronic
1107650730 13:42542097-42542119 CCTTAAAAACTGAAGGGAAAAGG - Intergenic
1107884614 13:44865066-44865088 CATCAAATACTAAAAAAAAGAGG + Intergenic
1107918885 13:45182846-45182868 CCTCAACCACAGAAAGAAAAAGG - Intronic
1108085580 13:46788140-46788162 CAAAAAAAACTGAAAGAAAAAGG - Intronic
1108249024 13:48546216-48546238 TCTCAAACACTGAAAGAAAAAGG - Intergenic
1108559153 13:51626209-51626231 CCTCAAGTATTTATAGAAAATGG - Intronic
1108696922 13:52910458-52910480 CCTCAAAAACTGCAAGACAGGGG + Intergenic
1109043528 13:57376032-57376054 CCACAAAAACTGAATGAAAACGG - Intergenic
1109239793 13:59871732-59871754 CTTCAAAAACAGAAAGAACAAGG - Intronic
1109597365 13:64573796-64573818 ACTCCAAAACTGAAAGCAAAAGG - Intergenic
1109831905 13:67801904-67801926 GCTCAGCTACTAAAAGAAAAAGG + Intergenic
1109927651 13:69167452-69167474 CCTCAAATACACAAAATAAAAGG - Intergenic
1110507700 13:76307547-76307569 CTTGAAATACTGAAAGATTAAGG - Intergenic
1110601530 13:77380224-77380246 CCTCAAAAAAAGAAAAAAAAAGG - Intergenic
1110924837 13:81138168-81138190 CCTGAAATAGTGCAAGAAAGAGG - Intergenic
1111190550 13:84801129-84801151 AATTAAATACTCAAAGAAAAAGG - Intergenic
1111389049 13:87567361-87567383 ACTCATAGACTGAAAGCAAAGGG + Intergenic
1111911327 13:94315598-94315620 CCTCACATAGAGAGAGAAAAAGG + Intronic
1111928230 13:94485481-94485503 CCTTAAATACTTAAAGGAAAAGG + Intergenic
1111978391 13:94991726-94991748 CCACAAAAATTGAAAAAAAAAGG - Intergenic
1112879807 13:104093023-104093045 ATTAAAATACTAAAAGAAAAAGG - Intergenic
1112925711 13:104672755-104672777 CCACAAACTCTGTAAGAAAAGGG + Intergenic
1113722767 13:112573324-112573346 TCTCAAAAACTAAAACAAAAAGG + Intronic
1113828908 13:113278808-113278830 TCTCAGTTACTGAAAGAAGAGGG - Intergenic
1115164025 14:30428144-30428166 CCTCAAAAACTCAAAATAAAAGG + Intergenic
1115231778 14:31168212-31168234 CCTCAAATACTTCTGGAAAAGGG + Intronic
1115686324 14:35800153-35800175 CATCAAGTACTGAGAGAAGAGGG - Intronic
1115881731 14:37927146-37927168 CCCCAAACACTGAAAGTAACAGG + Intronic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1117045875 14:51812914-51812936 ACTTAAATATTGGAAGAAAAAGG - Intergenic
1117416043 14:55496786-55496808 ACTCAATTACTGAAATAAAGAGG - Intergenic
1117847546 14:59927623-59927645 CCTTCAATACTTGAAGAAAATGG - Intronic
1118611935 14:67548012-67548034 CCTCCTCTACTGGAAGAAAAGGG - Intronic
1118705445 14:68476303-68476325 CCTCAAATAGCAAAAGAAATTGG - Intronic
1119829323 14:77686923-77686945 ACTCAAACACTGAAAGAATGGGG - Intronic
1120127401 14:80762184-80762206 CATTATATACTTAAAGAAAAGGG + Intronic
1120245890 14:82006110-82006132 CCTCAAATAATGGAAGCCAAAGG + Intergenic
1120393456 14:83938012-83938034 CAACAAATACTTAAGGAAAATGG + Intergenic
1121116753 14:91348992-91349014 ACTGAAATCCTGAAAGAAATTGG - Intronic
1121760282 14:96439212-96439234 CATCAACTACTGAATGAATATGG + Intronic
1202905723 14_GL000194v1_random:71443-71465 GTTCAAATACTGAATGGAAATGG + Intergenic
1124094123 15:26632942-26632964 CCTCCAGAACTGAATGAAAAAGG + Intronic
1124868757 15:33519867-33519889 CTTCATATACTTCAAGAAAAAGG + Intronic
1125090875 15:35791144-35791166 CCTTAAAGACCAAAAGAAAATGG - Intergenic
1125757130 15:42071602-42071624 CCTCAGGTACTGATGGAAAATGG + Intronic
1125800734 15:42444470-42444492 CCCAAAACACTGAAAGAAATTGG + Intronic
1126472350 15:49027193-49027215 ACTTAAATAATGAAACAAAATGG - Intronic
1126777282 15:52111362-52111384 CCTCAAAGAAAAAAAGAAAAAGG + Intronic
1126872579 15:53005527-53005549 CCTTTAATACAGAATGAAAACGG + Intergenic
1127112300 15:55687856-55687878 CCTCTGAGACTGAAAGAAAGAGG + Intronic
1129090191 15:73141750-73141772 TCACAAAGACTGAGAGAAAAGGG - Intronic
1129540558 15:76343920-76343942 TGGCAATTACTGAAAGAAAATGG + Intergenic
1130681131 15:85997630-85997652 CGTCAATTACTGAAAGGCAAGGG + Intergenic
1130694534 15:86117325-86117347 TCTCAAATACTGAGAAATAAAGG - Intergenic
1131973379 15:97915357-97915379 CATCAAATAATAAAAGAACAGGG - Intergenic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132452491 15:101976047-101976069 ACTTAAATACAGGAAGAAAAAGG - Intergenic
1132454407 16:14575-14597 ACTTAAATACAGGAAGAAAAAGG + Intronic
1132832681 16:1936823-1936845 GCTAAAACACTGAAAGAAACTGG + Intergenic
1134460932 16:14428638-14428660 CCTCTAAAACAGAAAAAAAAGGG + Intergenic
1136382702 16:29903488-29903510 TCTTAAAGACTGGAAGAAAATGG + Intronic
1137491723 16:48938587-48938609 CCTCAAATAGTTCAAGAATATGG + Intergenic
1137515257 16:49137962-49137984 CATGAAATCCTCAAAGAAAAAGG - Intergenic
1137786052 16:51138719-51138741 CCACAAATAGTGCAAGCAAAGGG + Exonic
1138984705 16:62314330-62314352 CCCAAAACACTGAAAGAAAGAGG - Intergenic
1139056871 16:63196253-63196275 CTTCAAATACTGACAGATAGTGG - Intergenic
1139181585 16:64754626-64754648 CGGAAAAAACTGAAAGAAAATGG + Intergenic
1140997372 16:80274281-80274303 ACTCACATACTGAAGCAAAAGGG + Intergenic
1142446795 16:90145026-90145048 CCACTAATACTACAAGAAAATGG + Intergenic
1142460709 17:90443-90465 CCACTAATACTACAAGAAAATGG - Intergenic
1142791092 17:2266675-2266697 CCTCACATATTGAAACAAAACGG + Intronic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1144241437 17:13316486-13316508 CCTGATTTACTGAAAGAAACAGG + Intergenic
1145814732 17:27787567-27787589 CCACAAATCTGGAAAGAAAAGGG + Intronic
1147370827 17:39991719-39991741 GATCAAATAATGAAAGAGAAAGG + Intronic
1148094819 17:45045014-45045036 CCCAAAATACTGAAAGAAACTGG - Intronic
1148946981 17:51271547-51271569 ACTGAAGTACAGAAAGAAAAAGG - Intronic
1149431552 17:56598198-56598220 TTTCAAATACTGGAAGAGAATGG + Intergenic
1150632228 17:66888039-66888061 CCTCAAGCACTGTAAAAAAATGG + Intergenic
1150931926 17:69594346-69594368 CCTCCAAAACTGAGACAAAATGG - Intergenic
1151160327 17:72159562-72159584 CATCCAATATTGAAAGGAAATGG + Intergenic
1151168869 17:72228656-72228678 TCTGTAAGACTGAAAGAAAAAGG - Intergenic
1151689010 17:75668736-75668758 CCACTAATACTAAAACAAAACGG - Intronic
1152858166 17:82678085-82678107 CTGCAAAGACTGAAACAAAATGG - Intronic
1153227346 18:2908921-2908943 CCTGAAAAACAGAAAGGAAATGG - Exonic
1154035677 18:10799589-10799611 CATAAACAACTGAAAGAAAAGGG + Intronic
1155487392 18:26360425-26360447 CCAGACAAACTGAAAGAAAATGG - Intronic
1155931308 18:31711757-31711779 CTTAAAATAGTGAAAGAAGATGG - Intergenic
1156018035 18:32568214-32568236 CCCAAAATACTGAAAGAAACTGG - Intergenic
1156899584 18:42285429-42285451 CCTCAAATACTTAAACAGAAAGG - Intergenic
1157076222 18:44470572-44470594 CCACATATGCCGAAAGAAAAAGG + Intergenic
1158071758 18:53478534-53478556 CCTCAAATATTTACAGAGAAAGG - Intronic
1159069567 18:63608286-63608308 CCTCATATGATGAAATAAAAAGG - Intergenic
1159127933 18:64246786-64246808 ACTCAAATACTGAGAGACAAGGG + Intergenic
1159211893 18:65333903-65333925 ACTCAAATATTGAAGTAAAATGG - Intergenic
1159997353 18:74979015-74979037 CATCAAATGCTGAGAGAGAAGGG + Intronic
1160629326 18:80234393-80234415 CCTTAAATTCTGTAAGATAAAGG + Intronic
1160650411 19:222805-222827 CCACTAATACTACAAGAAAATGG - Intergenic
1162194018 19:8969871-8969893 CATCAGTTGCTGAAAGAAAAGGG + Exonic
1164973811 19:32555136-32555158 CCTCACACACAAAAAGAAAATGG - Intergenic
1165001724 19:32769174-32769196 CATAAAATCCTAAAAGAAAAAGG - Intronic
1166202274 19:41245760-41245782 ACTGAAATCCAGAAAGAAAATGG + Intronic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1166450730 19:42898410-42898432 TGTCAAATCCTGAAAGTAAATGG + Intronic
1166622469 19:44314231-44314253 CCCAAAATACTGAAAGAAACTGG + Intergenic
924959797 2:23991-24013 CCTCAAATAATAAAAAAAAAAGG - Intergenic
925027050 2:618298-618320 CCTAAAATGCTGAAAGCAAAGGG + Intergenic
925504901 2:4551610-4551632 TCTTAAAAACTGAAAAAAAATGG + Intergenic
928107454 2:28480127-28480149 CCTAAAACACTGAAAGAAACTGG - Intronic
928276928 2:29910319-29910341 ACTGAAATACAGAGAGAAAAGGG + Intronic
928825117 2:35411150-35411172 ACTCAAATATGGAAATAAAAAGG - Intergenic
929149567 2:38735521-38735543 CCTAAAACACTAAAAGAAACTGG + Intronic
929708929 2:44246462-44246484 CCTCCCATACTGAATGAAACAGG + Intergenic
931068108 2:58610824-58610846 CCCAATATTCTGAAAGAAAAAGG - Intergenic
931245183 2:60486497-60486519 TCTAAGATACTGAAAGAAAATGG + Intronic
931533817 2:63249326-63249348 CCTTAATTTCTGTAAGAAAATGG + Intronic
933058274 2:77701600-77701622 CCTCAAATACTTGAAAAGAAGGG - Intergenic
933469449 2:82702645-82702667 CCTAAAATAAAGCAAGAAAATGG + Intergenic
934230690 2:90179170-90179192 CCTCAAAAAATGAAAAAAATTGG + Intergenic
936118479 2:109721685-109721707 AATAAAATACTGAAAGAAATGGG - Intergenic
936470562 2:112795166-112795188 CATGAAATACTGAATGAACAGGG - Intergenic
936568702 2:113598521-113598543 ACTTAAATACAGGAAGAAAAAGG - Intergenic
936820542 2:116514663-116514685 CTTCCAACAATGAAAGAAAAAGG + Intergenic
938386318 2:130869795-130869817 CCTGAAACCCTGAAAGGAAAAGG + Intronic
938868493 2:135449757-135449779 CCTCAAAAAAAGAAAGAAATGGG - Intronic
939058079 2:137386539-137386561 ACTCTAATAGTTAAAGAAAAAGG - Intronic
939960328 2:148560408-148560430 CCACAAAGAGTGGAAGAAAAAGG - Intergenic
940037199 2:149323420-149323442 ACTCAAATACAAAAAGCAAAAGG + Intergenic
940460529 2:153958384-153958406 TTTCTAAAACTGAAAGAAAACGG - Intronic
941202774 2:162533476-162533498 TTTAAAATACAGAAAGAAAATGG + Intronic
941273150 2:163455928-163455950 TCTCTAGTACTGAATGAAAAGGG - Intergenic
941363669 2:164583307-164583329 CCTCAAAGAAAGAAAAAAAAAGG + Intronic
941473229 2:165916574-165916596 CCAGAACTACTGAAATAAAAAGG - Intronic
941851124 2:170182426-170182448 ACTCAAATACACAAAGAAATAGG - Intronic
942659451 2:178248688-178248710 CCTCAAATCCCCAAACAAAAAGG - Intronic
943075262 2:183186919-183186941 TCACAAAGACTGAAAGTAAAGGG - Intergenic
943282481 2:185954376-185954398 CCTCAAATAAAAAAATAAAAAGG - Intergenic
943458801 2:188143386-188143408 GCTAAAATACAGAAAGCAAAGGG - Intergenic
943958282 2:194222334-194222356 CCACAAATTTTGAATGAAAATGG - Intergenic
943974802 2:194460697-194460719 TCTGAAATACTGAAATTAAAGGG + Intergenic
944453153 2:199864502-199864524 CATGAAATACTGAAATATAAGGG - Intergenic
944550644 2:200841633-200841655 TCTCAAAAAAAGAAAGAAAAAGG + Intergenic
945880319 2:215318301-215318323 CCTAAAATAAAGGAAGAAAAAGG + Intronic
946078493 2:217096243-217096265 CTTCTGATACAGAAAGAAAAGGG + Intergenic
946485242 2:220094960-220094982 CTTCAAAAGCTGAAAGATAATGG + Intergenic
946610925 2:221456864-221456886 ACTCAGAAACTGAAAGTAAATGG + Intronic
1169094848 20:2888149-2888171 CATGAAATACAGGAAGAAAAGGG - Intronic
1169175551 20:3509256-3509278 AGTCAAATATTGAAAGCAAAAGG + Intronic
1169918786 20:10710920-10710942 GATCAAATACTGAAGTAAAATGG + Intergenic
1170852798 20:20019584-20019606 TCTCAAAAAATAAAAGAAAATGG - Intronic
1170855861 20:20053202-20053224 CCTCAAAAACTGAAAAGCAAAGG + Intronic
1171119283 20:22554341-22554363 CCTCAAATAGTGTGAGAAAAAGG - Intergenic
1171121236 20:22570988-22571010 CCTCAATTACTAATAGAAAAAGG - Intergenic
1171288968 20:23969136-23969158 CCCCAAACACTGAAAGAAACTGG - Intergenic
1172987556 20:39004731-39004753 CCTCATCTAATGAAAGGAAAAGG - Intronic
1173302096 20:41813000-41813022 CCTAAAACACTGAAAGAAATTGG - Intergenic
1175019842 20:55833957-55833979 CTCAAAATAATGAAAGAAAAAGG + Intergenic
1176109928 20:63406540-63406562 ACTCAGTTACTGTAAGAAAAGGG + Exonic
1176275863 20:64268501-64268523 CCTGAAATAGTGAAACACAAAGG - Intronic
1176625078 21:9086200-9086222 GTTCAAATACTGAATGGAAATGG + Intergenic
1178514212 21:33232170-33232192 TCTCAAATGTTAAAAGAAAATGG + Intronic
1179077137 21:38133076-38133098 CCTCAATTATAGAAAGAAGAAGG + Intronic
1179166080 21:38936234-38936256 CCTGAAAGACTGGAAAAAAACGG + Intergenic
1179523708 21:41961890-41961912 CTTCACAGACTGAAAGAGAAGGG - Intergenic
1179566497 21:42252310-42252332 ATTCAAACTCTGAAAGAAAAAGG - Intronic
1179611027 21:42550290-42550312 CCACATTTACTGAAATAAAATGG + Intronic
1179798408 21:43798969-43798991 CCTCAGCTACTGAGAGAGAAGGG - Intronic
1183542640 22:38438386-38438408 TCTCAAAAAAAGAAAGAAAAAGG + Intronic
1183550724 22:38482482-38482504 CCTTAAGGACTGGAAGAAAATGG - Intronic
1184361570 22:44022299-44022321 CCTCCTTTACTGAAAGGAAAAGG + Intronic
949169125 3:977645-977667 CCTCCAATACTGAATGTAAAAGG - Intergenic
949756866 3:7422091-7422113 CCTCAAACACTCAAAAAACAGGG + Intronic
950225385 3:11229296-11229318 CCCCAAAAACTGAAAGAACCTGG + Intronic
950694627 3:14689337-14689359 ACTCAAATTCAAAAAGAAAATGG - Intronic
951958529 3:28286667-28286689 CCTCTAATACAAAAAGGAAATGG - Intronic
952024661 3:29064656-29064678 CATCAAACAGTAAAAGAAAATGG - Intergenic
953892029 3:46757974-46757996 CCTATAATACTCAAAGAAACAGG + Intronic
954454334 3:50589171-50589193 AATCAAACACTGAAAGAAAATGG - Intergenic
955786843 3:62550107-62550129 CCTCCAAACCTGGAAGAAAAGGG + Exonic
955787770 3:62558019-62558041 AATAAAATACTGAAATAAAAAGG - Intronic
955793960 3:62616053-62616075 CCTAAGCTACTGATAGAAAAGGG - Intronic
956541995 3:70349877-70349899 CAACAAACACTAAAAGAAAAAGG + Intergenic
957494268 3:80970088-80970110 CTTAAAATTCTGAAAGGAAATGG - Intergenic
957591383 3:82204114-82204136 CATCAAATATTGAAAGAAATAGG + Intergenic
958170621 3:89935059-89935081 CATCTGAAACTGAAAGAAAAAGG + Intergenic
959053200 3:101543917-101543939 GATTAAATTCTGAAAGAAAAAGG - Intergenic
959110808 3:102120410-102120432 CATCAAAAGCTGAAGGAAAATGG - Intronic
959430013 3:106241952-106241974 CCTTAAATCCTAAAAGAAAAGGG - Intergenic
959902959 3:111680385-111680407 CCTCAAATCCTGTAGGAAAATGG - Intronic
960758612 3:121048284-121048306 TCTCCAAGGCTGAAAGAAAAGGG - Intronic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
963359710 3:144255651-144255673 TCTCAAATACAAAAAGAAACAGG - Intergenic
964353842 3:155830755-155830777 ACTCAAATATTTAAAGAAATAGG + Intronic
964538960 3:157757730-157757752 AGGCAAATACTGACAGAAAAGGG + Intergenic
964829836 3:160872163-160872185 CCCCAAAAACTGACAGAAAATGG - Intronic
964858572 3:161174029-161174051 CATCAAATGCTGAAAAAAAGAGG - Intronic
964866962 3:161272727-161272749 CCTCAAAAAAAGAAAAAAAAAGG - Intergenic
965214125 3:165838912-165838934 ACTCAATTTCTGCAAGAAAATGG + Intergenic
965421063 3:168458598-168458620 AAGCAAAAACTGAAAGAAAAGGG - Intergenic
965620131 3:170634592-170634614 CCTCAAAAAAAGAAAAAAAAAGG + Intronic
965660343 3:171035113-171035135 CCTCAAAAAATTAAAGAGAAGGG - Intergenic
965661710 3:171048846-171048868 CATAAAATACTCAAAGAATAAGG + Intergenic
965680766 3:171248911-171248933 ATTCAAAGGCTGAAAGAAAAAGG - Intronic
965811941 3:172600291-172600313 TTTAAAAAACTGAAAGAAAAGGG + Intergenic
965927382 3:173998373-173998395 ACTTAAACACTCAAAGAAAATGG - Intronic
966499209 3:180619554-180619576 ATTCAAAGACTGAAAAAAAATGG - Intronic
966695059 3:182781026-182781048 CCTCAAATTCTGAAACTAAAGGG - Intergenic
967656879 3:192061038-192061060 CCATAAATTTTGAAAGAAAATGG + Intergenic
968013727 3:195306310-195306332 TCACAAATACTGAAATAAAATGG + Intronic
968367419 3:198197180-198197202 CCACTAATACTACAAGAAAATGG + Intergenic
970190979 4:13517763-13517785 CTTAACATACGGAAAGAAAATGG - Intergenic
970530128 4:16973264-16973286 CATCAAAGACGGAAAAAAAAAGG - Intergenic
970569995 4:17370644-17370666 GATCAAATAATGATAGAAAAAGG + Intergenic
970767704 4:19570443-19570465 CCTTCAATGCTGAAAGACAATGG + Intergenic
971108065 4:23549077-23549099 CCTAAATTATTGAAAAAAAAAGG + Intergenic
971623240 4:28884169-28884191 TTTCAAGTACTGAAAGAAAAAGG + Intergenic
972354637 4:38269000-38269022 CCTCTAGTACTGCAAGAGAAAGG - Intergenic
972876161 4:43363584-43363606 CCTCATATACTCACACAAAAAGG + Intergenic
973126022 4:46585732-46585754 TCCAAAATACTGAAAGAAACTGG - Intergenic
973996007 4:56459769-56459791 CCACCAATACTTAAGGAAAAAGG - Exonic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
974762607 4:66297633-66297655 CCTCAAATTTTGAATGTAAATGG + Intergenic
974872890 4:67665262-67665284 TCACCAATACTAAAAGAAAATGG + Exonic
975420717 4:74160710-74160732 CCTCAAATACCACAACAAAATGG - Intronic
975594546 4:76036839-76036861 CCTCAAATTCATCAAGAAAAGGG - Intronic
975790988 4:77950870-77950892 TCTCAAAAACTAAAATAAAATGG - Intronic
975831926 4:78378257-78378279 ACTCATCTACAGAAAGAAAAAGG - Intronic
976259072 4:83128529-83128551 TCTCAAAAAATGAAAGGAAAAGG - Intronic
976862212 4:89678997-89679019 ACTCATATACTGAGAGATAAAGG - Intergenic
976913565 4:90340323-90340345 CCTCAAAAACTAAAAGCAAGCGG + Intronic
978691677 4:111520195-111520217 CCTTAAAAACAGAAACAAAAAGG - Intergenic
979255836 4:118606884-118606906 CCACTAATACTACAAGAAAATGG + Intergenic
979332508 4:119433651-119433673 CCACTAATACTACAAGAAAATGG - Intergenic
979556779 4:122056785-122056807 GCTCAAATTCTGATATAAAATGG - Intergenic
979772686 4:124548395-124548417 CCACAAATGGTGAAAGGAAAAGG - Intergenic
980219135 4:129892706-129892728 CCACAAAAAAAGAAAGAAAATGG + Intergenic
980400992 4:132285539-132285561 CCTCAAATACAAAAACAAAGTGG - Intergenic
980574093 4:134663222-134663244 CATAAAGTACTGAAAGAATATGG - Intergenic
980631457 4:135440751-135440773 ACTCATAGACTGAAAGCAAAGGG + Intergenic
980851780 4:138391244-138391266 ACTCCAATACTGACATAAAATGG - Intergenic
982513419 4:156313897-156313919 AATAAAATAGTGAAAGAAAATGG + Intergenic
983579831 4:169297309-169297331 ACTCAAAGACTGAAAATAAAGGG + Intergenic
984474109 4:180215478-180215500 CCGCAACTACTACAAGAAAATGG - Intergenic
986612944 5:9588281-9588303 ACGCAAAGAATGAAAGAAAATGG - Intergenic
987651613 5:20748607-20748629 CCAGCATTACTGAAAGAAAAGGG + Intergenic
987832961 5:23121881-23121903 TTTCAAATTCTGAAAAAAAATGG - Intergenic
987912608 5:24168463-24168485 CCCTAAATATTGGAAGAAAAAGG + Intronic
987933880 5:24438344-24438366 GCTCAAATCCTGATGGAAAATGG + Intergenic
988429513 5:31102825-31102847 TCTCAAAAAATAAAAGAAAAAGG + Intergenic
988743947 5:34112871-34112893 CCCGCATTACTGAAAGAAAAGGG - Intronic
988786449 5:34569797-34569819 GTTCCAATACTGAAAGACAAAGG - Intergenic
990165335 5:52988518-52988540 ACTGAAATAATGGAAGAAAATGG + Intergenic
990260431 5:54016022-54016044 CCTCAGCTACAGAAAGGAAAAGG - Intronic
990294831 5:54390421-54390443 CCTCAAATAATGAGTGAAATAGG + Intergenic
992522973 5:77575401-77575423 GCTTAAATACTGAAAGCACATGG - Intronic
992818859 5:80473381-80473403 TCTCAAAAAAAGAAAGAAAATGG - Intronic
993599902 5:89909048-89909070 CTTCAAGTACTGACAGAAGATGG + Intergenic
993621326 5:90171420-90171442 CCTCAACTAATAAAAGCAAAGGG + Intergenic
995140508 5:108730033-108730055 CCACAAAGACAGAAAGAAAAAGG + Intergenic
995563101 5:113404166-113404188 CCTCAAATAAAGAAACAAACTGG - Intronic
996128825 5:119756238-119756260 ACTGAAATAATGAAAGGAAAAGG - Intergenic
996294194 5:121891929-121891951 GCTCAAAACCTGAAAGACAATGG + Intergenic
996388979 5:122939639-122939661 CTACAAAAACTAAAAGAAAATGG - Intronic
996436782 5:123442599-123442621 AGTAAAACACTGAAAGAAAAAGG + Intergenic
996439456 5:123473169-123473191 TCACAAAGACTGAAAGTAAATGG - Intergenic
996444121 5:123524853-123524875 CCTTAAACACTGAAGGATAATGG + Intronic
996459209 5:123721958-123721980 TCATAAATACCGAAAGAAAAGGG - Intergenic
996542818 5:124647941-124647963 ACTCAAAGACAAAAAGAAAAAGG - Exonic
998238964 5:140425665-140425687 CTTAAAATACTGGAATAAAAAGG - Intronic
998516230 5:142756759-142756781 CCTAAAATACTAAAAGCTAAAGG + Intergenic
998721811 5:144960592-144960614 TCTCACTTACTGAAAAAAAATGG + Intergenic
998866836 5:146513925-146513947 CCTCAAATACAAATAGAAGATGG - Exonic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
1001593365 5:172881562-172881584 CCTCAAACACAGAAAGCTAAAGG - Intronic
1001652530 5:173326294-173326316 CCACAAATACTTTAATAAAATGG - Intronic
1001853373 5:174989183-174989205 CCCAAAACACTGAAAGAAACTGG + Intergenic
1002084300 5:176762251-176762273 TCTCACATACTTACAGAAAACGG - Intergenic
1002726644 5:181302401-181302423 CCACTAATACTACAAGAAAATGG + Intergenic
1003037202 6:2652765-2652787 CATAAAACACTGAAAGAAAAAGG + Intergenic
1003193049 6:3890915-3890937 CCTCACATAGTGGAAGAAGAAGG - Intergenic
1006875247 6:37289884-37289906 CCTCAACTACACAAAGCAAATGG + Intronic
1007866754 6:44979275-44979297 TCTTAAATTCTGAAAGAAAATGG - Intronic
1008141639 6:47838910-47838932 TCTCAAAGAAAGAAAGAAAATGG - Intergenic
1008240830 6:49109458-49109480 CCTAAAACAATGAAAGAAAATGG - Intergenic
1008410991 6:51179632-51179654 CATCAAATATTGAAAGAAGATGG - Intergenic
1008732091 6:54494755-54494777 CCCCAAACACTGAAAGATATTGG - Intergenic
1008966549 6:57318332-57318354 CCACAAACACAGAAAAAAAATGG - Intronic
1009462450 6:63930745-63930767 CCTCCAATACTGCAGGAAAGTGG + Intronic
1009812368 6:68684913-68684935 GGTAAAATACTCAAAGAAAAAGG + Intronic
1010393619 6:75365285-75365307 TCTGAAAGACTAAAAGAAAAGGG + Intronic
1010462358 6:76127960-76127982 CCCAAAACACTGAAAGAAATGGG + Intergenic
1010978639 6:82344582-82344604 CCAAAAATAAAGAAAGAAAAGGG - Intergenic
1011150850 6:84271830-84271852 TCTCAGATAATGAAATAAAAAGG - Intergenic
1011203413 6:84863859-84863881 TTTTAAATTCTGAAAGAAAATGG - Intergenic
1011800458 6:91008469-91008491 CTAAAAATACTGAAAGAGAATGG - Intergenic
1011863222 6:91786736-91786758 CCTGAAACAGTGAAAGAAACTGG + Intergenic
1012157859 6:95842294-95842316 CCTTGAATACTAAAAGCAAATGG + Intergenic
1012335988 6:98058903-98058925 CATCAAAGACTAAAAGAAAAGGG + Intergenic
1012622805 6:101367561-101367583 GCTCACTTAATGAAAGAAAAAGG + Intergenic
1013523450 6:110953742-110953764 CCTGAAAAAGTGACAGAAAATGG + Intergenic
1013794467 6:113870615-113870637 CCTCAGACACTGGAGGAAAATGG - Intergenic
1013872518 6:114783213-114783235 CCTGAAGTGCTGAAAGAAAAGGG - Intergenic
1014767490 6:125423516-125423538 CCTCAGAAACTGATAGAAAATGG - Intergenic
1014785234 6:125611247-125611269 CCCCAAAAAAAGAAAGAAAAAGG - Intergenic
1015316067 6:131817905-131817927 CCTGAAATACGGTGAGAAAATGG - Intronic
1016525696 6:144999316-144999338 CTTAAAATGCTGAAAGGAAAGGG - Intergenic
1016642426 6:146364502-146364524 CATGAAATAGTTAAAGAAAAAGG - Intronic
1017206108 6:151805950-151805972 CTACAAGTCCTGAAAGAAAAAGG - Intronic
1017343442 6:153353302-153353324 TCTCAAAAAAGGAAAGAAAAGGG - Intergenic
1017402369 6:154078899-154078921 CCTAAAAGACTAAAAGAATATGG + Intronic
1017803240 6:157918465-157918487 ACACATATACTGAAAGTAAACGG - Intronic
1018163208 6:161068244-161068266 GCACAAATACTGTGAGAAAAGGG + Intronic
1019841605 7:3451584-3451606 TCTCACATAGTGAAAGATAATGG - Intronic
1020110881 7:5447114-5447136 CCTTAAAAACTAAAAGAAAGTGG - Intronic
1020331454 7:7021328-7021350 AATCAAATATTTAAAGAAAAAGG - Intergenic
1020364436 7:7365468-7365490 GCTCAAAGGCTGAAAGAGAATGG - Intronic
1020967055 7:14884318-14884340 CCTGTAATACTGAGGGAAAATGG - Intronic
1021015985 7:15534350-15534372 CTTCAAGTGTTGAAAGAAAAAGG + Intronic
1021226406 7:18032849-18032871 TATCAAATACTGAAAGAAATAGG + Intergenic
1021970576 7:25961822-25961844 GCTAAAATAATGAAAGAAGAGGG + Intergenic
1022204966 7:28154818-28154840 CCTACAATATTGAAAAAAAAAGG + Intronic
1022555130 7:31286457-31286479 ATTTAACTACTGAAAGAAAAGGG - Intergenic
1022847416 7:34224840-34224862 CCCCAAATTCTGCAAGAACAAGG + Intergenic
1023073286 7:36458885-36458907 CTCCCAATACTAAAAGAAAAGGG - Intergenic
1023397916 7:39768773-39768795 CCACTAATACTACAAGAAAATGG + Intergenic
1023970499 7:44987162-44987184 GCTGAAATTTTGAAAGAAAAAGG - Intergenic
1024003567 7:45208718-45208740 CATCAAATAATGAAGGACAATGG - Intergenic
1025063834 7:55835742-55835764 CCTCAAAAAAAGAAAGAATATGG - Intronic
1025134745 7:56401718-56401740 CCACTAATACTACAAGAAAATGG - Intergenic
1025969606 7:66309955-66309977 CCTGAGATACAGAAAGAATAGGG + Intronic
1027231211 7:76273720-76273742 ACTAAAATAAAGAAAGAAAAGGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028290235 7:89056555-89056577 TCAAAAATACTGCAAGAAAAAGG - Intronic
1028381681 7:90207254-90207276 CATCAAATGCTGAAAGCACATGG + Intronic
1029043033 7:97597607-97597629 CCTAGAATACTAGAAGAAAATGG - Intergenic
1030312481 7:108082442-108082464 CCACTAATACTGAAAGATTATGG - Intronic
1031604659 7:123754104-123754126 CTTCAAATACTGAAGAAAACTGG - Intergenic
1031650834 7:124287731-124287753 CCTCAGATATTCAAAGAAAGGGG - Intergenic
1031925273 7:127632764-127632786 CCCAAAACACTGAAAGAAACCGG - Intergenic
1032048160 7:128627602-128627624 CCACTAATACTACAAGAAAATGG + Intergenic
1033459666 7:141534012-141534034 AAGCAAATATTGAAAGAAAAGGG - Intergenic
1033639794 7:143251258-143251280 ACACAAAGACTGAAAGCAAAGGG + Intronic
1033677172 7:143554232-143554254 ACACACAGACTGAAAGAAAAAGG - Intergenic
1033694663 7:143775205-143775227 ACACACAGACTGAAAGAAAAAGG + Intergenic
1036825450 8:11972274-11972296 CCTTAGAAACTGCAAGAAAAGGG + Intergenic
1037471370 8:19214912-19214934 CCTCAAAGACTGAGAAATAAGGG + Intergenic
1038225370 8:25652086-25652108 ACACATAGACTGAAAGAAAAAGG - Intergenic
1038489951 8:27963676-27963698 GCCCAAATACTGAAAGTAAAAGG - Intronic
1039668278 8:39561936-39561958 CCTGGAATACCGAAATAAAAAGG - Intergenic
1039682678 8:39759180-39759202 TGTCCAATACTGAAAGAAAATGG + Intronic
1041267203 8:56076756-56076778 CCTCAAATACTTAAAGGATGAGG - Intergenic
1042911900 8:73836312-73836334 CCTGAAATAGTGAGAGAGAAGGG + Intronic
1043145122 8:76643451-76643473 CCTCAAAGACCTAAAGAAAGTGG - Intergenic
1043402220 8:79894951-79894973 CATCACATACAGAAAGAAAGTGG - Intergenic
1043704095 8:83327345-83327367 TCTCATATACTGGAAGACAAAGG - Intergenic
1044812441 8:96077496-96077518 CATTAAATACTAAAAGACAATGG - Intergenic
1045133877 8:99191082-99191104 ACTGAAATGCTGAAAGAAAAAGG - Intronic
1045368186 8:101494689-101494711 ACTCGAATTCTGAATGAAAACGG + Intronic
1046699932 8:117388718-117388740 CCTCAGGTAAAGAAAGAAAAGGG - Intergenic
1046922086 8:119741831-119741853 CCTCAAATTCTCAAGGAACAGGG - Intronic
1048192469 8:132302309-132302331 CCTCTTCTACTGAAAGAAAAAGG + Intronic
1049852361 8:144839774-144839796 CATCAGATACTGAAAGATATTGG + Intronic
1049883825 9:15004-15026 ACTTAAATACAGGAAGAAAAAGG + Intergenic
1050845547 9:10213291-10213313 CCTGAAATCCTGAGAGAATAAGG + Intronic
1051002887 9:12306708-12306730 TCTCAGACCCTGAAAGAAAAAGG + Intergenic
1052128141 9:24805138-24805160 ACTAAAATAATGTAAGAAAAGGG + Intergenic
1053224161 9:36337400-36337422 TCTCAAAAACTTACAGAAAAAGG + Exonic
1053274777 9:36775063-36775085 CCTCAAACATTGAAAGAGATGGG + Intergenic
1055133243 9:72800014-72800036 CCTCAGAAACTGAAAAAGAAAGG + Intronic
1055355989 9:75437386-75437408 CCTGAAATACAGAGAGTAAAAGG - Intergenic
1055683919 9:78749449-78749471 CTTCAAATAATTAAAGAATAGGG - Intergenic
1055905601 9:81290627-81290649 CCACATAAACTTAAAGAAAAAGG - Intergenic
1056872645 9:90298373-90298395 CAAAAAATACTCAAAGAAAATGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057696415 9:97326001-97326023 CATCACATTCTGAAAGAAAAAGG + Intronic
1057909776 9:99009675-99009697 CCTCAAAGAGTTAAAAAAAAAGG + Intronic
1058238776 9:102528970-102528992 CCTCACATGATGGAAGAAAAAGG + Intergenic
1058568442 9:106312709-106312731 CCTCAAATATGGTAAGAAATTGG - Intergenic
1058620868 9:106881306-106881328 CTACCAATACTGACAGAAAAGGG - Intronic
1059801938 9:117758858-117758880 CTGCTAATACTGAAAGCAAAGGG - Intergenic
1060033390 9:120234608-120234630 CAGCATATATTGAAAGAAAAAGG - Intergenic
1060559319 9:124529883-124529905 AGTCAGATACTGAAAGAAATTGG - Intronic
1061460085 9:130730571-130730593 CCTCAAACAAAGAAAAAAAAAGG - Intronic
1061659669 9:132120645-132120667 CCACAGATAGGGAAAGAAAAGGG + Intergenic
1061748099 9:132754738-132754760 CTCCAACTACTTAAAGAAAAAGG + Intronic
1061751858 9:132784052-132784074 CCTGAAATACTGTAAGTGAAAGG + Intronic
1062751776 9:138260029-138260051 CCACTAATACTACAAGAAAATGG + Intergenic
1203748252 Un_GL000218v1:56656-56678 GTTCAAATACTGAATGGAAATGG + Intergenic
1185794470 X:2953163-2953185 GCAAAAATACTGAAAGAGAAAGG - Exonic
1186161166 X:6778567-6778589 CCTCAAGTACTGCATCAAAAGGG - Intergenic
1186283568 X:8020225-8020247 CTTTAAAAAGTGAAAGAAAATGG - Intergenic
1186533147 X:10317767-10317789 CCCAAAACACTGAAAGAAACTGG + Intergenic
1187189034 X:17015349-17015371 CATCAAATTCTGTAAGACAAGGG + Intronic
1187857580 X:23651942-23651964 ACTCAAATTCTCAAAGAAAATGG - Intergenic
1189531046 X:41883496-41883518 ACTCAAAAGCTGAAAGAAAAGGG + Intronic
1190430080 X:50370477-50370499 CCCCAAATTGGGAAAGAAAAAGG - Exonic
1190468723 X:50753859-50753881 TCTCAAATACCGAAAGCAAAAGG - Intronic
1192109196 X:68347109-68347131 CCTCCAATACTAAAAGACACTGG - Intronic
1193670973 X:84385747-84385769 CCTTAAAGACTGTAAAAAAAAGG - Intronic
1193766912 X:85540963-85540985 CCTCAAATACTAATAGGATATGG - Intergenic
1193987059 X:88256149-88256171 ACCCATATACTGAAAAAAAAAGG - Intergenic
1195196810 X:102505098-102505120 CTTCCAATTCTGAAAGAAGATGG - Intergenic
1195266662 X:103187826-103187848 ACTCAATTACTAGAAGAAAATGG + Intergenic
1195824107 X:108978571-108978593 CGTTAAATACTGAAAGTCAAGGG + Intergenic
1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG + Intergenic
1196623640 X:117852838-117852860 CTTGAAATACAGAAAGAAACTGG + Intergenic
1198586870 X:138131374-138131396 CATCAAATAATGAAAGACAATGG - Intergenic
1198602141 X:138295411-138295433 CCCCAAACTATGAAAGAAAATGG - Intergenic
1199352916 X:146825056-146825078 CATCAAAAAAGGAAAGAAAATGG + Intergenic
1200401987 X:156025155-156025177 ACTTAAATACAGGAAGAAAAAGG - Intergenic
1201161602 Y:11171630-11171652 GGTCAAATACTGAATGGAAATGG + Intergenic