ID: 1085755757

View in Genome Browser
Species Human (GRCh38)
Location 11:79200056-79200078
Sequence GATGCTTCTAGAGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085755757_1085755761 7 Left 1085755757 11:79200056-79200078 CCTGCAGCATCTCTAGAAGCATC 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1085755761 11:79200086-79200108 TCTTCTCGCCTTCTCTCCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 265
1085755757_1085755760 6 Left 1085755757 11:79200056-79200078 CCTGCAGCATCTCTAGAAGCATC 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1085755760 11:79200085-79200107 CTCTTCTCGCCTTCTCTCCTGGG 0: 1
1: 0
2: 2
3: 57
4: 391
1085755757_1085755759 5 Left 1085755757 11:79200056-79200078 CCTGCAGCATCTCTAGAAGCATC 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1085755759 11:79200084-79200106 ACTCTTCTCGCCTTCTCTCCTGG 0: 1
1: 0
2: 4
3: 34
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085755757 Original CRISPR GATGCTTCTAGAGATGCTGC AGG (reversed) Intronic
901313731 1:8290860-8290882 GATGCTTTTGGTGATGCTGGGGG + Intergenic
901337149 1:8460285-8460307 AAGGCATCTGGAGATGCTGCTGG + Intronic
902335746 1:15753697-15753719 GATGCTGGGATAGATGCTGCTGG + Intergenic
902845092 1:19104096-19104118 CATGCTGCTGGAGATGCTGGAGG - Exonic
903504635 1:23824946-23824968 GTTGCTTTTAGAGATGCTTGGGG - Intronic
904261790 1:29291743-29291765 GATGCTTCTAGGACAGCTGCTGG + Intronic
905387056 1:37612356-37612378 GAGCCTTCTGGAGAAGCTGCTGG - Exonic
909567046 1:77064350-77064372 GATGCTTCGAGAGAAGCAGGGGG - Exonic
910826260 1:91410829-91410851 GATGCAGCAAGAGAAGCTGCAGG + Intergenic
913387471 1:118275115-118275137 GATGCTGCCAGAGGTGCTGATGG + Intergenic
914000405 1:143689872-143689894 GATGCTTTTTGAGAGGCTGAGGG - Intergenic
914197700 1:145457969-145457991 GATGCTTTTTGAGAGGCTGAGGG - Intergenic
914476804 1:148031081-148031103 GATGCTTTTTGAGAGGCTGAGGG - Intergenic
915268398 1:154734620-154734642 GATGCATCTAGAGATGGGCCTGG + Intronic
915804168 1:158827565-158827587 TATACTTCTTGAAATGCTGCAGG + Intergenic
916827202 1:168453766-168453788 GAGGCTACTTGAGAGGCTGCAGG + Intergenic
919368729 1:196698848-196698870 TAAGCTTTTAGATATGCTGCTGG - Intronic
919850758 1:201670681-201670703 GATGGTGGTAGAGATGCTGGTGG + Intronic
920179673 1:204124708-204124730 GATACTTCTCCAGGTGCTGCCGG - Exonic
920962378 1:210674840-210674862 GCTGCTTCTGGAGATACTGCAGG - Exonic
923993896 1:239470209-239470231 GAAGCCTATAGTGATGCTGCTGG + Intronic
1063564274 10:7158947-7158969 GATGCTTCCAGAGATCATGCTGG + Exonic
1065770413 10:29072853-29072875 GATGGGTCTGGAGCTGCTGCAGG + Intergenic
1067161407 10:43827915-43827937 GCTGCTTGTCCAGATGCTGCAGG + Intergenic
1068050485 10:51943822-51943844 TAAGCTTCTTGAGGTGCTGCTGG + Intronic
1069002809 10:63284499-63284521 GGTGTTTCTGCAGATGCTGCTGG - Intronic
1077096299 11:800527-800549 GATGCTGGTAGGGATGCTGGTGG - Exonic
1078090961 11:8264263-8264285 GATGCTTTTGGGGGTGCTGCTGG - Intronic
1083994677 11:66266164-66266186 GATGCTGGTAAAGAAGCTGCAGG + Exonic
1084275473 11:68049102-68049124 GCTGCTGCTGGAGACGCTGCCGG + Exonic
1084965081 11:72740257-72740279 GATGCTGGTAGGGTTGCTGCAGG - Intronic
1085052816 11:73388540-73388562 AAAGCTTCTAGAGAAGCTTCTGG + Intronic
1085262943 11:75218732-75218754 GATGCAGCTAGAGAGGTTGCAGG - Intergenic
1085755757 11:79200056-79200078 GATGCTTCTAGAGATGCTGCAGG - Intronic
1086577699 11:88359460-88359482 AATGCTTCTTGAGTTGCTACAGG - Intergenic
1087164573 11:94988777-94988799 GAAGCTTCTAAGGATGCTTCTGG + Intronic
1088196224 11:107276878-107276900 GATGTGTCCAGAGATGCTGAAGG - Intergenic
1088608500 11:111554572-111554594 GTTCCTTCTAGAGAAGCTGAAGG + Exonic
1088804043 11:113334628-113334650 GATGCTTGTAAAAATCCTGCCGG - Intronic
1089104071 11:115987445-115987467 GATGCTTCCATAGAGGCTGGGGG + Intergenic
1089928643 11:122285836-122285858 CATGCTACTGGGGATGCTGCAGG + Intergenic
1091196230 11:133732964-133732986 GATGCATCTAGAGAAGCTCATGG - Intergenic
1093109053 12:15127033-15127055 GATGCTTCTTTAGATACCGCAGG - Intronic
1093969458 12:25361671-25361693 GATGATTCTTGAGCTGCTGGTGG - Intergenic
1095527953 12:43150473-43150495 AATGATTCTAGAGATGGTTCAGG - Intergenic
1096574191 12:52542513-52542535 GAGGCTTCTCTAGATGATGCTGG - Intergenic
1100667502 12:96770929-96770951 GATGCTTCTAGTCAGCCTGCTGG + Intronic
1102384447 12:112496329-112496351 GATGATTCTAGGGCTGCGGCAGG - Intronic
1103535124 12:121628688-121628710 GCTGCTTTTAGAGATTCTTCAGG - Intronic
1104723539 12:131060575-131060597 GATGCCCCTGGAGAGGCTGCTGG - Intronic
1104857991 12:131910751-131910773 GCTGCTGCTGGAGCTGCTGCCGG - Exonic
1107320343 13:39179746-39179768 GTTCCTTCTGGAGATGCTGAGGG + Intergenic
1112087702 13:96049104-96049126 TAAGCTTTTTGAGATGCTGCTGG - Intronic
1114560813 14:23589173-23589195 GATGGGGCCAGAGATGCTGCTGG + Intergenic
1116572098 14:46531441-46531463 TATGCTTTTTGATATGCTGCTGG + Intergenic
1116841811 14:49826385-49826407 AGTGCTTCTAAAGATGCTACAGG + Intronic
1118208053 14:63741684-63741706 GATGATCCTAGAGATGCCACAGG + Intergenic
1119080202 14:71685580-71685602 GATGCTTCGAGGGATGTTGGCGG - Exonic
1122064386 14:99161729-99161751 GCTGCTTCTATAGTTGCTGAAGG - Intergenic
1125797371 15:42412708-42412730 GATGCCTATAGATATGCCGCAGG - Intergenic
1129314204 15:74731396-74731418 GATGAGTCTGGAGATGCTGCAGG + Intergenic
1130303808 15:82699673-82699695 GGTCCTTCCAGAGATGCTTCTGG + Intronic
1130795773 15:87207797-87207819 GCTGCTTCCAGAGAAACTGCAGG + Intergenic
1135192234 16:20364052-20364074 GGGGCTGCCAGAGATGCTGCAGG - Intronic
1136576905 16:31130550-31130572 GGTGCTGCTAGAGATCCTGCGGG + Exonic
1137741553 16:50780948-50780970 AATGCTTGTAGAAATGGTGCGGG + Intronic
1138047008 16:53735651-53735673 GCTGCTTCCTGAGCTGCTGCTGG - Intronic
1139299089 16:65929169-65929191 TAAGCTTTTAGATATGCTGCTGG - Intergenic
1140446947 16:75037121-75037143 AAAGCTTCAAAAGATGCTGCTGG - Intronic
1146311906 17:31775946-31775968 GCTGCTTCCAGAGATGCAGCAGG - Intergenic
1147519795 17:41160089-41160111 ACTGCTGCTAGAGATACTGCAGG + Exonic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148153597 17:45410504-45410526 TATGCTTCTAGAAACACTGCTGG + Intronic
1151032590 17:70758442-70758464 GTACCTTCTAGAGATGCAGCAGG + Intergenic
1151085543 17:71376279-71376301 GATGCTGCTAAACATTCTGCAGG + Intergenic
1152373267 17:79903818-79903840 GATGGTTCTAGAGCTTGTGCAGG - Intergenic
1153556935 18:6324390-6324412 GATGCTCCTGGAAAAGCTGCAGG + Intronic
1153612794 18:6904012-6904034 GATACTTCTAGATAATCTGCAGG + Intronic
1154093688 18:11389560-11389582 GATGCTTCTACTAATGCTGAAGG - Intergenic
1155377645 18:25178229-25178251 GAGGCTTCTAGAAATGTTGGAGG + Intronic
1155896084 18:31328680-31328702 AATGATTCTAGAGCTACTGCAGG + Intronic
1155896087 18:31328779-31328801 AATGATTCTAGAGCTACTGCAGG + Intronic
1156227807 18:35126356-35126378 GCTGATTCTAGGGATGGTGCAGG - Intronic
1157764375 18:50285913-50285935 GCTGCTGCTGGTGATGCTGCAGG + Exonic
1158066128 18:53410727-53410749 GTTGCTAATAGAGATGGTGCAGG - Intronic
1160434620 18:78837673-78837695 GATGCTTCTAAACATGCCACAGG - Intergenic
1161864622 19:6825046-6825068 GGGGCTTCAAGAAATGCTGCGGG - Exonic
1161992357 19:7691231-7691253 GGTGCTTGTAGCGATGATGCTGG - Intronic
925579860 2:5399313-5399335 CAAGCTTCCAGCGATGCTGCTGG - Intergenic
926083503 2:10006953-10006975 GATGCTTCCAGAGGGGCTACTGG - Intergenic
929283149 2:40105266-40105288 GATGATTCTGCAGAGGCTGCTGG - Intronic
934756418 2:96827771-96827793 GATGCTTCAACAGGTGCAGCAGG - Exonic
935188015 2:100751678-100751700 GCAGCTTCTTAAGATGCTGCAGG + Intergenic
937297768 2:120820070-120820092 GATGCCTCAGTAGATGCTGCTGG - Intronic
940372894 2:152922431-152922453 GGTGCGTAGAGAGATGCTGCGGG + Intergenic
942540766 2:177013152-177013174 GATGCATCTAGAAAAGCGGCTGG + Intergenic
942600588 2:177636966-177636988 TCTGCTACCAGAGATGCTGCTGG - Intronic
942608049 2:177712666-177712688 AATGCTTCTTGGGTTGCTGCTGG + Intronic
943435616 2:187862567-187862589 ACTGCTTCTAGATATGCTGGTGG + Intergenic
946429110 2:219615189-219615211 GAGGCTTCGCCAGATGCTGCTGG - Exonic
947931245 2:233966931-233966953 CATGCTTTAAGAGATGGTGCAGG + Intronic
948124048 2:235551859-235551881 GGAGCTTCTAGTGATGCTGGAGG + Intronic
1173983424 20:47242266-47242288 GATGGTTATCGAGATGTTGCTGG + Intronic
1174548944 20:51347331-51347353 GATGCTGGTAGTGATGCTGATGG + Intergenic
1175185104 20:57174630-57174652 GCTGCTTCTCAAGATGATGCCGG - Intronic
1175270428 20:57730116-57730138 GAAACATGTAGAGATGCTGCTGG - Intergenic
1175887414 20:62300301-62300323 GCTGCTCCTCTAGATGCTGCGGG + Intergenic
1175961310 20:62638008-62638030 GACCCTTCTAGAGAGGCTGTGGG + Intergenic
1177265891 21:18783454-18783476 GATGCTTTTAGAGTTACTGTTGG - Intergenic
1178415372 21:32400608-32400630 TCTGCTTCTAGGGAGGCTGCAGG - Intergenic
1179049380 21:37875557-37875579 TATGCTTCTGAAGCTGCTGCAGG + Intronic
950604243 3:14064343-14064365 GCTGCTGCTGGAGCTGCTGCTGG - Exonic
950604262 3:14064451-14064473 GCTGCTGCTAGAGCTGCTACTGG - Exonic
950604286 3:14064634-14064656 GCTGCTGCTAGAGCTGCTACTGG - Exonic
950636675 3:14320358-14320380 CATGCTTCTGGAGGAGCTGCTGG - Intergenic
951335203 3:21412658-21412680 GATGTTCCTAGAGCTGCTGAAGG + Intergenic
951640727 3:24831626-24831648 GATGCTTATAGATATGGTGGGGG + Intergenic
952221523 3:31328346-31328368 GATGCTTCTAGGGAGGCCTCAGG + Intergenic
955318631 3:57958967-57958989 GTTTCTTCTGGAGATGGTGCAGG + Intergenic
956554310 3:70500904-70500926 GGTGCTTGCAGAGATGATGCTGG + Intergenic
956578705 3:70784742-70784764 TCTGCTTCTAGGGAGGCTGCAGG - Intergenic
958766034 3:98368796-98368818 GCTGATTCTAGGAATGCTGCGGG - Intergenic
958790522 3:98645723-98645745 GATCCTTCAAAAGAAGCTGCAGG - Intergenic
962339220 3:134567972-134567994 CATGCTTGTAGAGATACTGAGGG - Intronic
966135359 3:176692021-176692043 GTTGCATGTAAAGATGCTGCTGG + Intergenic
966920984 3:184611194-184611216 GATGGTGATAGAGATGCTGATGG - Intronic
967509956 3:190299657-190299679 GATGCTTCAATACATGCTGTGGG - Intergenic
967938086 3:194745376-194745398 GAGGCAGCGAGAGATGCTGCTGG + Intergenic
969350890 4:6597264-6597286 GAAGCTGCTGGAGCTGCTGCAGG - Exonic
971151477 4:24037095-24037117 GATGCTTCCAGAGAGGTGGCTGG - Intergenic
972592709 4:40503271-40503293 GATGCTTTTGGAGGTGCTGATGG + Intronic
974675384 4:65081043-65081065 GATGCTGATGGTGATGCTGCTGG + Intergenic
976289377 4:83401651-83401673 TAAGCTTCTTGATATGCTGCTGG - Intergenic
977998673 4:103528915-103528937 TAAGCTTCTTGATATGCTGCTGG - Intergenic
978697225 4:111596790-111596812 GAGTTTTCTAGAGATACTGCGGG + Intergenic
981245889 4:142537206-142537228 TAGGCTTCTAGAGATGGTACTGG + Intronic
983650810 4:170034806-170034828 GATGCTTCTAGAAATGGTTTTGG - Intergenic
984372214 4:178882604-178882626 CATGCTTCTGGAAAAGCTGCAGG + Intergenic
989135011 5:38144884-38144906 GAAGCTGCTATATATGCTGCCGG + Intergenic
989200613 5:38759057-38759079 GATGCTGCGGGAGATGCTGCGGG - Intergenic
990024090 5:51163986-51164008 AAGGCTTCTTGACATGCTGCTGG - Intergenic
990111583 5:52331903-52331925 GATGCTTATAGAGATGCTAATGG + Intergenic
990957995 5:61363082-61363104 GATGTTTTTAGAGATGTTGTAGG + Intronic
991098306 5:62762892-62762914 GATGCTTCTTGAGATGGGTCTGG - Intergenic
992057738 5:73008806-73008828 GATGCCACTACAGATCCTGCTGG + Intronic
992078227 5:73210834-73210856 TATGCTTTTAGATATGTTGCTGG - Intergenic
994580242 5:101632486-101632508 CATGCTTCTGGAGAAGCTGCAGG - Intergenic
995216349 5:109599665-109599687 GAGGCTTCCAGAGAAGCTTCAGG + Intergenic
997738260 5:136230784-136230806 GAAGCTTCCAGAGGTGATGCTGG - Intronic
1003344283 6:5252186-5252208 GATGTTTCTACAGATTTTGCAGG + Intronic
1006795711 6:36731106-36731128 GATGGCACTAGAGATGCTGCAGG - Intronic
1008599083 6:53072099-53072121 AATGCTGCTAAAGATTCTGCAGG + Intronic
1008816854 6:55578992-55579014 GATGCTCCCGGAGAAGCTGCTGG + Exonic
1011230197 6:85152395-85152417 CATGCTTCTAGATATGTGGCAGG + Intergenic
1012021833 6:93932160-93932182 GAAGAATCTAGAGATGTTGCAGG - Intergenic
1012419034 6:99042140-99042162 GGTTCTTCTAGAAATGCTGATGG - Intergenic
1013319112 6:108969337-108969359 GAAGCTTTTATAGATGCTGCAGG + Intronic
1017640945 6:156493519-156493541 GATTCTTCTTGAGTTGCTGCAGG - Intergenic
1018246952 6:161832820-161832842 GATGCTGCTGGAGACCCTGCAGG - Intronic
1018699750 6:166416897-166416919 GATGATTGTAGAGATGATGGTGG - Intronic
1018932760 6:168252642-168252664 GATGCTGCTGGAGAAGGTGCTGG + Intergenic
1018935674 6:168272488-168272510 GATGCTCCGAGAGCTGCTCCTGG + Intergenic
1020144194 7:5630229-5630251 GCTTCTTCAAGAGAGGCTGCTGG + Intronic
1027447534 7:78291705-78291727 GAAGCTTCTTGATGTGCTGCTGG - Intronic
1028311052 7:89336477-89336499 GTTGCTTCTGCATATGCTGCTGG - Exonic
1029091704 7:98053514-98053536 GCTGCTTCAAGAAATGATGCTGG - Intergenic
1033037160 7:137885474-137885496 GAAGCTTCTGGAGTTGCTGAAGG + Exonic
1033727639 7:144136371-144136393 GATGGTGCGAGAGATGCTGGGGG - Intergenic
1035470847 7:159107681-159107703 GCTGCTTCTGGAACTGCTGCAGG + Intronic
1035470861 7:159107735-159107757 ACTGCTTCTGGAGCTGCTGCAGG + Intronic
1037950690 8:23017256-23017278 GATGCTTCTCGAAATACTCCTGG - Exonic
1040510268 8:48087210-48087232 GGTCCTTCTGGAGCTGCTGCAGG + Intergenic
1043087681 8:75855689-75855711 CAGGCTTCTAGAGCTGATGCAGG + Intergenic
1043886880 8:85611136-85611158 TATGCGTCTAGAGATGCTGGTGG + Intergenic
1045134214 8:99195794-99195816 GATTCTTCAATAAATGCTGCTGG - Intronic
1045385862 8:101670446-101670468 GAGGCTGCTGGAGATGCTGCTGG - Intergenic
1045973734 8:108107921-108107943 GAAGCTTTTTGATATGCTGCTGG - Intergenic
1045975352 8:108125166-108125188 GAAGCTTTTTGATATGCTGCTGG - Intergenic
1046475976 8:114743840-114743862 GCTGCTGCTAGTGATGCTGCCGG + Intergenic
1048621071 8:136133456-136133478 TATGCTTCTATAAATCCTGCTGG + Intergenic
1049228487 8:141469694-141469716 GATGCTTGTAGTGATGGTGGTGG + Intergenic
1049254980 8:141608953-141608975 GACCCTTCTAGAAATTCTGCTGG + Intergenic
1050291082 9:4155843-4155865 GATGCTGATACTGATGCTGCAGG + Intronic
1052553623 9:29985169-29985191 GTTGCTTCTAGAGATTTGGCTGG + Intergenic
1057085644 9:92207389-92207411 GCTGCTTCTAGAGCTGGAGCTGG - Intergenic
1058197153 9:101991733-101991755 GATATTTCTAGAAATGCTGGAGG - Intergenic
1059872196 9:118589868-118589890 AATACTTCTAGAAATTCTGCTGG - Intergenic
1060450586 9:123735025-123735047 GATGCTCATGGAGATGTTGCTGG + Intronic
1061776057 9:132965268-132965290 GCTGCTTCCAGAAATGCAGCAGG + Intronic
1062367229 9:136216674-136216696 GAAGCTGTTGGAGATGCTGCAGG - Exonic
1062504122 9:136864545-136864567 GATGTTTCTGGAGAGCCTGCAGG - Intronic
1186647507 X:11523007-11523029 GAAGCTTCTTGATGTGCTGCTGG - Intronic
1191950611 X:66587642-66587664 TAAGCTTCTTGATATGCTGCTGG + Intergenic
1194536807 X:95115700-95115722 TGTGCTTTTAGATATGCTGCTGG + Intergenic
1195351938 X:104004636-104004658 CACGCTTCTTGAGATGCTGCTGG - Intergenic
1197352495 X:125395275-125395297 GATAATACTAGAGATGATGCAGG + Intergenic
1198293364 X:135260162-135260184 GAAGCTTCTTGATGTGCTGCTGG + Intronic
1199022159 X:142893717-142893739 GATACTTCCAGGGCTGCTGCTGG - Intergenic
1201582435 Y:15524372-15524394 GAAGCTTCTTGATGTGCTGCTGG - Intergenic