ID: 1085762323

View in Genome Browser
Species Human (GRCh38)
Location 11:79252705-79252727
Sequence GTCAAGCTCCCTAGTGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085762323_1085762331 25 Left 1085762323 11:79252705-79252727 CCCTACCCACTAGGGAGCTTGAC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1085762331 11:79252753-79252775 AATGTGCCCCAGCTCTCCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 175
1085762323_1085762332 26 Left 1085762323 11:79252705-79252727 CCCTACCCACTAGGGAGCTTGAC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1085762332 11:79252754-79252776 ATGTGCCCCAGCTCTCCTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085762323 Original CRISPR GTCAAGCTCCCTAGTGGGTA GGG (reversed) Intronic
903080379 1:20806251-20806273 GGCAAGCTACTTTGTGGGTAAGG - Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
907017052 1:51026625-51026647 CTCAACCTCCCAAGTAGGTAGGG + Intergenic
918500179 1:185186291-185186313 GTGAATCTTCCTAGTGGGTTGGG - Intronic
921293834 1:213683711-213683733 GCCAAGGTCCCTAGTGGGTGGGG - Intergenic
923499534 1:234553345-234553367 GACAAGCTTCCCAGTGGGTCAGG - Intergenic
1071344691 10:84681898-84681920 CTGAAGCTCCCTTGTGGTTAGGG + Intergenic
1079772320 11:24477160-24477182 GTCTAACACCCTACTGGGTAAGG + Intergenic
1081694282 11:45098785-45098807 GTAGTGCTCCATAGTGGGTATGG + Intronic
1085750790 11:79159346-79159368 GTGATGCTACCTAGTGCGTAGGG - Intronic
1085762323 11:79252705-79252727 GTCAAGCTCCCTAGTGGGTAGGG - Intronic
1089377273 11:118003315-118003337 GTCAAGCTTCCTAGTATCTAGGG - Intergenic
1089618622 11:119709553-119709575 GGCTAGCTCCCTAGTCTGTAAGG + Intronic
1091324939 11:134679023-134679045 GACAAGCTCCCATGTGTGTAAGG - Intergenic
1092215241 12:6677401-6677423 GTCACGTGCCCTAGTGGGTTTGG - Intronic
1095513326 12:42977745-42977767 GTCAAGCTCCATAATGGTTAAGG + Intergenic
1096519657 12:52177466-52177488 GTCCAGCTCCCAAGTGTGTTTGG - Intronic
1098941159 12:76538103-76538125 GTCAAGGTCTCTAATTGGTATGG - Intronic
1103748876 12:123145324-123145346 CTCAAACTCCCTATTGGGTGTGG - Intronic
1105580646 13:21692675-21692697 GTCACGCTCCCAAGTGTGTGGGG + Intronic
1110091474 13:71454282-71454304 GTCCAGTTCCCTAGTGAGAATGG - Intronic
1115037773 14:28881471-28881493 GTTAAGCTCCCTGAAGGGTAGGG - Intergenic
1124662786 15:31563688-31563710 GCCAAGCTCCCCAGTGTGTTAGG - Intronic
1127893022 15:63271531-63271553 GCCAAGCCCCTTACTGGGTATGG - Intergenic
1128708216 15:69852575-69852597 CTAAAGTTCCCTAGTGGGGAGGG + Intergenic
1136147257 16:28322663-28322685 CTCCACCTCCCCAGTGGGTATGG + Exonic
1146172409 17:30644186-30644208 GTCTAGCTCCTTCGTGGGCAAGG + Intergenic
1146345863 17:32060197-32060219 GTCTAGCTCCTTCGTGGGCAAGG + Intergenic
1150827384 17:68488863-68488885 GTCAGGCTCCCTGGTGGATATGG + Intergenic
1157203078 18:45675868-45675890 GTCAAGCTTACTTGTGCGTAGGG + Intronic
1162990018 19:14295878-14295900 GTCTAGCTCCTTCGTGGGCAAGG - Intergenic
930024703 2:47023041-47023063 TTCAAACTTCCTAGTGGGTCAGG + Intronic
941668460 2:168264708-168264730 GTCAAGCTCCTTTGAGGGTAGGG - Intergenic
944391543 2:199224729-199224751 GTCCAGTTCCCTAGTAGGTAAGG + Intergenic
947463066 2:230319856-230319878 CTCATGCTCCCCAGTGGGGAAGG + Intergenic
948190945 2:236058086-236058108 GTCAGCATCCCTAGGGGGTAGGG + Intronic
1174366817 20:50061490-50061512 GTCAAGCTCCTTGGGGGATAGGG - Intergenic
1175959935 20:62630897-62630919 GACAAGCTCCCTGGTGGAAAGGG - Intergenic
1178043829 21:28671737-28671759 GCCAAGCTTCCTAGTGACTAAGG - Intergenic
1179046783 21:37851840-37851862 ATCAAGGTCCCTAGCTGGTATGG - Intronic
949543311 3:5051103-5051125 GTAAAGCCACCTAGTAGGTATGG - Intergenic
953207371 3:40843229-40843251 CTCATGCTCCCTAGTAGCTAGGG - Intergenic
962248848 3:133822386-133822408 TGGAATCTCCCTAGTGGGTATGG + Intronic
962848463 3:139290288-139290310 GTCCAGCTCCCTGCTGGATAGGG - Intronic
962975173 3:140440017-140440039 GTCATGCTCCTGAGTGGGAACGG + Intronic
969254818 4:5994553-5994575 CTCAAGCTCCCTTCTGGGGAGGG - Intergenic
974661032 4:64888786-64888808 GTCCAGCTCCCCAGGGAGTAAGG + Intergenic
982256263 4:153454400-153454422 GTCATGCTCAGTAGTGGATACGG - Intergenic
988684449 5:33513896-33513918 GCCAAGCTCCCTAGGGAGTCTGG - Intergenic
988826289 5:34938759-34938781 AGCAAGCTCTCTAGTGGGAATGG + Intronic
992781325 5:80130866-80130888 TTCAAGCTCCCTTAGGGGTAGGG - Intronic
993470551 5:88302280-88302302 CTCAACCTCCCTAGTAGCTAGGG - Intergenic
995840947 5:116442600-116442622 ATGAAGCTCCCTAGAGGTTAGGG - Intergenic
1000643616 5:163735198-163735220 CTCAAACTGCCTAGTGGGAATGG - Intergenic
1007476789 6:42124518-42124540 GCCAGGCTGCCCAGTGGGTAGGG - Intronic
1008457520 6:51727888-51727910 CTCAACATTCCTAGTGGGTAGGG + Intronic
1013160848 6:107543283-107543305 GGCAAGCTCCCCAGTGGTCATGG + Intronic
1026228866 7:68466103-68466125 GTCAGCCTCCCTAGTAGCTACGG - Intergenic
1029452110 7:100647084-100647106 GTCCTGCTCCCTTCTGGGTAGGG - Exonic
1029798930 7:102925540-102925562 GTCAAGCTCCCTAGAGGTGGTGG + Intronic
1041125009 8:54627842-54627864 GGCAAGCTCCCTCATAGGTATGG - Exonic
1054948698 9:70824995-70825017 AGCAAGCTCCTTAGAGGGTAGGG - Intronic
1057959433 9:99440265-99440287 GTCAGGCTCCCTAGTTGGACTGG + Intergenic
1061085392 9:128395082-128395104 TTCTAGATCCCTAGTGGGTGCGG - Intergenic
1186773725 X:12843187-12843209 GTCTAGTTCCCCAGTGGGGAAGG - Intergenic
1195687769 X:107601590-107601612 TTCAAGCTTCCTAGAGGGCATGG - Exonic