ID: 1085764116

View in Genome Browser
Species Human (GRCh38)
Location 11:79267808-79267830
Sequence CTATGATTCTTACAGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085764116 Original CRISPR CTATGATTCTTACAGAGCCC AGG Intronic
900972357 1:5998603-5998625 CCTGGATTCTTCCAGAGCCCGGG + Intronic
901550215 1:9990401-9990423 CTTTGATTTTAACAGAGCCATGG - Intergenic
902655591 1:17865870-17865892 CTAAGCATCCTACAGAGCCCAGG - Intergenic
903726141 1:25446876-25446898 CTATGATTCCTTCAGATACCAGG + Exonic
907642781 1:56208076-56208098 TTCTGATTGTTACTGAGCCCAGG - Intergenic
908176001 1:61555649-61555671 CTAAGATTCTTACACAGCACAGG + Intergenic
908419046 1:63941706-63941728 TTATGATCCATACAAAGCCCTGG - Intronic
909292857 1:73906041-73906063 CTATGATTCTTAAGAATCCCTGG + Intergenic
912548614 1:110469092-110469114 CAATGTCTCTTACACAGCCCTGG - Intergenic
912976830 1:114338678-114338700 GTATGATGTTTACACAGCCCCGG + Intergenic
920076286 1:203339589-203339611 CTCTGTTTCTTACAAAGCACTGG + Intergenic
920447606 1:206030970-206030992 CTTTGCTTGTTACTGAGCCCAGG + Intergenic
1063414388 10:5861670-5861692 CAATGATTCTCAAAGAACCCAGG - Exonic
1065731307 10:28712108-28712130 CTATGATACTTAAAGAGAACTGG - Intergenic
1066543501 10:36474780-36474802 ATCTGACTCTTACAGAGCTCTGG + Intergenic
1067820520 10:49524770-49524792 CTATTGTTCTTTCAGAGCCGGGG - Exonic
1069230815 10:66006620-66006642 ACATGATTCTTACAGAGCCTGGG + Intronic
1069904930 10:71726588-71726610 CCCTGGTTCTTACAGGGCCCTGG + Intronic
1070402076 10:76061770-76061792 CCATGATTCTTCAAGTGCCCAGG + Intronic
1071374013 10:84984135-84984157 CTATGATTTTTACATAGTCGAGG + Intergenic
1072766475 10:98098596-98098618 CTGTGTTTCAGACAGAGCCCTGG + Intergenic
1078457768 11:11488737-11488759 CTCTCACTCTTACAGGGCCCAGG - Intronic
1079294965 11:19225068-19225090 CTATGTTTCTTCCAGAACCCAGG - Intronic
1079601257 11:22315315-22315337 CTGTGACCCTCACAGAGCCCCGG - Intergenic
1080042468 11:27773345-27773367 TTATGGTTTTTTCAGAGCCCAGG + Intergenic
1080532265 11:33188579-33188601 CTCTGATGCTTACAGAGGCCAGG - Intergenic
1081726575 11:45333963-45333985 CTTTCATGCTAACAGAGCCCTGG - Intergenic
1084864383 11:72043614-72043636 CTATGCTTCTCCCAAAGCCCTGG + Intronic
1085764116 11:79267808-79267830 CTATGATTCTTACAGAGCCCAGG + Intronic
1089083252 11:115795290-115795312 CTTTGAATCTTAGAGAGCCTGGG - Intergenic
1089333329 11:117705225-117705247 CTCTGATGGTTACAGAGGCCGGG + Intronic
1090946044 11:131430668-131430690 CCATGCTTCTTCCTGAGCCCTGG + Intronic
1092661205 12:10740187-10740209 GTAAAGTTCTTACAGAGCCCAGG + Intergenic
1093760499 12:22904052-22904074 CTTTGATTCTAACTGACCCCAGG - Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1100646242 12:96534448-96534470 CTAGCATCCTTACAAAGCCCAGG - Intronic
1107100283 13:36582989-36583011 CTATGGTTCCTTCAGAGCCCTGG + Intergenic
1109045914 13:57410148-57410170 CTGTGATTCTTACAGACTCATGG - Intergenic
1109923852 13:69107136-69107158 CTGTGATTCTTGCAGACTCCTGG - Intergenic
1111328423 13:86731079-86731101 CTATGTTAGTTTCAGAGCCCAGG - Intergenic
1112617877 13:101023993-101024015 CTAAGATTCTTTCAGAGGGCAGG + Intergenic
1114409174 14:22484685-22484707 CTAGCATTCTTCCAGAGCTCTGG + Intergenic
1116244207 14:42388015-42388037 CTATGTCTCTTACAAAGCACAGG - Intergenic
1122771141 14:104098515-104098537 CCCTGCTTCTTACAGAGCCCTGG - Intronic
1126230503 15:46317847-46317869 CTATGACTCACACATAGCCCAGG + Intergenic
1126458027 15:48885833-48885855 CTTTGCTTCTTACACAGCTCTGG + Intronic
1130746398 15:86658571-86658593 CTATGACTCTTACAGCCTCCTGG + Intronic
1131030927 15:89185409-89185431 CTGTGGTTCTTCCAGGGCCCAGG + Exonic
1132321254 15:100927194-100927216 CGTTGATTCTTACAGGTCCCAGG + Intronic
1138058622 16:53863620-53863642 CTGTGATACTCACAGACCCCTGG - Intronic
1142104430 16:88294849-88294871 CTTTGGTTATTACAGAGACCTGG - Intergenic
1144133211 17:12267822-12267844 CAATGATTCTTCCAGAAGCCTGG - Intergenic
1148798541 17:50209416-50209438 CTATGACACTTCAAGAGCCCAGG + Intergenic
1149304692 17:55336118-55336140 CTGTGATCCTTACAGTGCCTTGG - Intergenic
1154173074 18:12064348-12064370 CTATGATTCACACTTAGCCCGGG + Intergenic
1155648070 18:28105453-28105475 CTATGAATTTTACAGAGTTCTGG + Intronic
1157010011 18:43635932-43635954 CTTTAATGCTTACAGAGCTCAGG + Intergenic
1161886585 19:7001178-7001200 CTGCCATTCTGACAGAGCCCAGG - Intergenic
1165162129 19:33822821-33822843 CTAAGATACTCACAGATCCCAGG + Intergenic
1165421471 19:35724089-35724111 CTATCAGACTGACAGAGCCCTGG - Intronic
929818260 2:45253326-45253348 CAATGATTCATACAAAGCCACGG + Intergenic
932845237 2:75128379-75128401 CTTTGATTTTTGCAGAGCCAGGG + Intronic
933399942 2:81783248-81783270 CTATAAATCTTACCGAGCCTGGG - Intergenic
934925102 2:98376749-98376771 CTATGAGTCTTGAGGAGCCCAGG - Intronic
937554379 2:123134977-123134999 CTATGATATTTAGAGAGCCATGG - Intergenic
938023728 2:127926803-127926825 CTCTCTTTCTCACAGAGCCCTGG - Intergenic
943584456 2:189721653-189721675 AAATTATTCTTACAGAACCCAGG - Intronic
947333094 2:229051096-229051118 CTAGAATTCCTACAGAGCCCAGG - Intronic
947964587 2:234268645-234268667 CTATGATTCCTACAGAAGCAAGG - Intergenic
948524907 2:238565521-238565543 CTGTGAAGCTTGCAGAGCCCTGG - Intergenic
1169678357 20:8180539-8180561 CTCTGTTTCTTATATAGCCCTGG - Intronic
1174582047 20:51579148-51579170 CTATGTTTCATACCAAGCCCAGG + Intergenic
1174977169 20:55349008-55349030 CCATCACTCTCACAGAGCCCCGG + Intergenic
1177739593 21:25137201-25137223 CTGTGATTCTAACATAGCCCAGG - Intergenic
1178591089 21:33910732-33910754 TTATGATTCTCTCAGAGCCCAGG - Intronic
1182242203 22:28924960-28924982 CTATGATTTTTACAGAGACTGGG - Intronic
1184976747 22:48067533-48067555 CTGTGACTCTCACAAAGCCCAGG + Intergenic
1185042714 22:48513663-48513685 CTGTGGTTCTGACAGGGCCCTGG + Intronic
957258429 3:77869273-77869295 CTATTATTATTACAGAACCTGGG + Intergenic
958872428 3:99576669-99576691 TTATTATTATTACAGAGCCTTGG - Intergenic
959769972 3:110082393-110082415 CTATGATTACAACATAGCCCAGG - Intergenic
960525537 3:118705538-118705560 CCATTATTCTTTCACAGCCCTGG + Intergenic
962457156 3:135575080-135575102 ATATGATGCTTTCAGTGCCCAGG + Intergenic
963024488 3:140905329-140905351 ATATGATTCTTACATAGCACAGG - Intergenic
969407130 4:7000983-7001005 ATTTGATCTTTACAGAGCCCTGG + Intronic
973707968 4:53598614-53598636 CTATGTTTCTTCCAGATACCAGG - Intronic
973881388 4:55274687-55274709 CTATCATTTTAATAGAGCCCAGG - Intergenic
974881670 4:67766159-67766181 CTATGATTCTCCAAGAGTCCCGG + Intergenic
975429173 4:74267917-74267939 CTAGGTTCCTTACAGAGCTCAGG - Intronic
976313217 4:83633197-83633219 CTATGATTCCGACAGACCCCAGG + Intergenic
979250032 4:118557622-118557644 CTAGGATGCTTTCAGAGCACTGG - Intergenic
983650340 4:170030827-170030849 CTGTGCTTCTTACATAGCCTTGG + Intronic
985920816 5:2971352-2971374 CCATCATTCTCAAAGAGCCCAGG + Intergenic
988713861 5:33805141-33805163 CTATGCTTTATACACAGCCCTGG + Intronic
990688014 5:58329713-58329735 CTATGATTTATACAGAGCATGGG - Intergenic
994226347 5:97255164-97255186 CTGTGATTCTTGCAGACTCCTGG - Intergenic
996338324 5:122408818-122408840 ATATGCTGCTTACAGAGGCCTGG - Intronic
1000695965 5:164384344-164384366 CTTTGTTTCTCACTGAGCCCAGG + Intergenic
1011547111 6:88493600-88493622 CTAAGAGTTTTACAGAGCTCAGG - Intergenic
1013492108 6:110658088-110658110 CAATGTTTCTTACAGTGCTCTGG - Intronic
1018628967 6:165805764-165805786 CTATGATTCATACCGAGTTCGGG + Intronic
1019780895 7:2938983-2939005 CTAAGCTTCTTAGAGACCCCAGG - Intronic
1022263620 7:28731854-28731876 CTATGATTCTTCCAGAGACTTGG + Intronic
1027720420 7:81734763-81734785 ATATGAAGCTCACAGAGCCCTGG - Intronic
1034826996 7:154274914-154274936 CTGTGATTATGACAGAGCCTGGG - Intronic
1037746248 8:21647180-21647202 CTATGACTCTGTGAGAGCCCAGG - Intergenic
1041326233 8:56668363-56668385 CTATGATTCTTACTGTACCTTGG - Intergenic
1043835748 8:85043806-85043828 CGATGTTTCTAACAGATCCCTGG + Intergenic
1044742823 8:95344997-95345019 CTGTGATATTTACAGCGCCCAGG - Intergenic
1048143139 8:131814843-131814865 CTATGATTCATACAGAAGTCTGG + Intergenic
1060912299 9:127360826-127360848 CTAGGATTGTTACAGAACCCGGG - Intronic
1186046433 X:5541752-5541774 GTATGAATCTGACAGAGCCATGG - Intergenic
1189136845 X:38559410-38559432 CTTTCATTCTTACAGACTCCAGG - Intronic
1190982044 X:55464634-55464656 CTATGGTGCTTCCACAGCCCGGG - Intergenic
1190986654 X:55508546-55508568 CTATGGTGCTTCCACAGCCCGGG + Intergenic
1193849555 X:86519506-86519528 CTATGAATCCAACAGATCCCAGG + Intronic
1195079219 X:101355417-101355439 CTCTGATGCTTACAGGGGCCAGG + Intronic
1201515151 Y:14812329-14812351 CGATGTTCCTTCCAGAGCCCTGG + Intronic