ID: 1085769025

View in Genome Browser
Species Human (GRCh38)
Location 11:79308768-79308790
Sequence CTGTGGGTCTCGCACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085769025_1085769029 -1 Left 1085769025 11:79308768-79308790 CCTCCTGAGTGCGAGACCCACAG 0: 1
1: 0
2: 0
3: 23
4: 97
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769025_1085769032 26 Left 1085769025 11:79308768-79308790 CCTCCTGAGTGCGAGACCCACAG 0: 1
1: 0
2: 0
3: 23
4: 97
Right 1085769032 11:79308817-79308839 TAGTTTCCTCACCCGTAAAATGG 0: 1
1: 18
2: 360
3: 2532
4: 8258
1085769025_1085769030 0 Left 1085769025 11:79308768-79308790 CCTCCTGAGTGCGAGACCCACAG 0: 1
1: 0
2: 0
3: 23
4: 97
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769025_1085769033 27 Left 1085769025 11:79308768-79308790 CCTCCTGAGTGCGAGACCCACAG 0: 1
1: 0
2: 0
3: 23
4: 97
Right 1085769033 11:79308818-79308840 AGTTTCCTCACCCGTAAAATGGG 0: 2
1: 104
2: 1283
3: 4868
4: 11113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085769025 Original CRISPR CTGTGGGTCTCGCACTCAGG AGG (reversed) Intronic
900660883 1:3782836-3782858 CTGTGGTCCCAGCACTCAGGAGG + Intronic
902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG + Intronic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG + Intronic
903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG + Intergenic
904330309 1:29754256-29754278 CGGTGGGCCTGGCACTCAGTGGG - Intergenic
904876447 1:33658173-33658195 CTGGGTGTCTGCCACTCAGGAGG + Intronic
906282496 1:44563932-44563954 GTGTGGGTCTCTAACTCAGGAGG - Intronic
913479757 1:119276700-119276722 CTGTAGGGCAGGCACTCAGGAGG + Intergenic
915354084 1:155245300-155245322 CAGTGGGTCTAACACTCAGTAGG - Intergenic
920217683 1:204373028-204373050 CTGTAGTCCTAGCACTCAGGGGG - Intronic
920710396 1:208289096-208289118 CTTTGGGTCTGGAACTCAGTAGG + Intergenic
924012261 1:239677976-239677998 CTGTGGATCGCGCCCTCAGCGGG + Intronic
1062997454 10:1880490-1880512 CTCTGGGTCTTGTTCTCAGGAGG + Intergenic
1066245312 10:33577500-33577522 CTGTAGTCCTAGCACTCAGGAGG + Intergenic
1066711005 10:38233753-38233775 GTGTGGGTCTGGCCCTCAGCAGG + Intergenic
1068118086 10:52756658-52756680 ATGTGGTTCTTACACTCAGGTGG + Intergenic
1069923689 10:71833334-71833356 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1076525397 10:131109517-131109539 CTGTTGTTCTCCCACTGAGGCGG - Intronic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1083674811 11:64319315-64319337 CTGAGGGTCCCACCCTCAGGAGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1094832750 12:34307927-34307949 CAGTGAGTGTCGCACCCAGGGGG + Intergenic
1095098519 12:38160270-38160292 TTGTGTGTCTCGCCCACAGGGGG + Intergenic
1095098626 12:38160723-38160745 GTGCGTGTCTCGCCCTCAGGGGG - Intergenic
1097439103 12:59587605-59587627 CTCTGGGTCTCACAATCTGGGGG - Intergenic
1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG + Intronic
1104721740 12:131048292-131048314 CTGTGAGTCTCGCACTCCCCAGG + Intronic
1105291266 13:19055251-19055273 CTGTGGGATTCTCACTGAGGAGG - Intergenic
1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG + Intergenic
1107239054 13:38210443-38210465 CTTTGGGTCTCCCCCTTAGGAGG - Intergenic
1107819300 13:44271938-44271960 ATGTGGGCATAGCACTCAGGAGG - Intergenic
1108574706 13:51781391-51781413 CACTGGGTCTGGCACTCAGTGGG - Intronic
1112602430 13:100869535-100869557 CTGTGGATCTGGCACACAGTGGG - Intergenic
1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG + Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125475725 15:40046949-40046971 CTGTGGGTCTGTCACAGAGGTGG - Intergenic
1126194548 15:45917681-45917703 CTGGGGGCCTGGCACTCAGCTGG + Intergenic
1126795787 15:52259806-52259828 CTGTTGGACTTGCACCCAGGTGG - Intronic
1131634165 15:94212457-94212479 CTGCCGGCCTCTCACTCAGGAGG + Intergenic
1132342555 15:101087583-101087605 CTGTGGGTCACCCAGCCAGGAGG - Intergenic
1134766439 16:16762939-16762961 CTGTAGCTCCAGCACTCAGGGGG - Intergenic
1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG + Intronic
1139451011 16:67028452-67028474 ATGTGGGTCTAGCACACAGTGGG - Intergenic
1140228707 16:73099748-73099770 CTGTGTGTCCTGCTCTCAGGAGG + Intergenic
1141154497 16:81587796-81587818 CTGAGGCTCTCACCCTCAGGAGG - Intronic
1147455755 17:40537108-40537130 AGGTGGGTCTTGCACTCAGAGGG - Intergenic
1147769170 17:42856023-42856045 CTGTGGGTGTCACCCTCTGGGGG + Intronic
1149126499 17:53240975-53240997 CTGTAATTCTAGCACTCAGGTGG + Intergenic
1149658546 17:58322961-58322983 CTGTGGCTCTCCCACTGAGCCGG + Exonic
1158401069 18:57121982-57122004 CTGTGGGTCTTTCACCCAGCTGG - Intergenic
1159841824 18:73407055-73407077 CTGGGGCTCTCACACTCATGGGG - Intergenic
1161431765 19:4236672-4236694 CTGTGGATGTCTCACCCAGGAGG - Intronic
1162499848 19:11046551-11046573 CTGTGCTTCCAGCACTCAGGAGG - Intronic
1163653367 19:18531828-18531850 GTGGGGGGCTGGCACTCAGGCGG + Exonic
1165207652 19:34204594-34204616 CTGTAGTCCTAGCACTCAGGAGG + Intronic
1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG + Intronic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1168126722 19:54288065-54288087 CTGTGGGTTTGTCACGCAGGGGG - Intergenic
927250460 2:20991363-20991385 CTGTGAGTCTCCCAGTCTGGTGG - Intergenic
937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG + Intergenic
937255967 2:120555774-120555796 CTGTGAGTCTCCGACGCAGGTGG + Intergenic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
946014061 2:216589740-216589762 CTGTGGTTCTGGCTCTCACGGGG - Intergenic
947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG + Intronic
947795977 2:232894264-232894286 CTGTGGAAAACGCACTCAGGAGG + Intronic
948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG + Intronic
1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG + Intronic
1171816187 20:29787783-29787805 CTGTGGGACTCGCATTCTGGAGG - Intergenic
1172551649 20:35805158-35805180 CTGTGGTCCCAGCACTCAGGAGG - Intronic
1173745494 20:45433617-45433639 CTGTAGGTCTGGAATTCAGGCGG - Intergenic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
951687856 3:25364443-25364465 ATGTGGGCTTCACACTCAGGAGG + Intronic
953559236 3:43971887-43971909 CTGTGGGTGTCTCACTCTGGGGG - Intergenic
955093603 3:55775407-55775429 CTGTGGTTCGAGCTCTCAGGAGG + Intronic
955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG + Intergenic
961627170 3:128272126-128272148 GTGTGGGCCACACACTCAGGTGG + Intronic
967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG + Intergenic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
970825937 4:20274667-20274689 CTGTGGATTTCACACTCAGAAGG - Intronic
971480536 4:27110708-27110730 CTCTGGGAATCCCACTCAGGAGG - Intergenic
976538519 4:86245689-86245711 TTGTGGGTCTACCACTCAAGAGG + Intronic
983399628 4:167246406-167246428 CTGTGGGTCAGGAATTCAGGAGG - Intergenic
985267466 4:188163379-188163401 CTGTTGGCCTAGAACTCAGGAGG + Intergenic
985802039 5:2010825-2010847 CTGTGGGGCTCGCCATCAGCGGG - Intergenic
992853357 5:80834216-80834238 CTGTGGGACTCACACCCTGGAGG - Intronic
996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG + Intergenic
998533570 5:142908270-142908292 CTGTGGGTCACGAATTCAGGGGG + Intronic
999187757 5:149725417-149725439 CTGTGGTTCTCAGACTCTGGAGG - Intergenic
1003872755 6:10415016-10415038 CTCTCGGTCTCGCACCCAAGTGG + Exonic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1005601158 6:27427635-27427657 ATGTGGGTCTTGAGCTCAGGAGG - Intergenic
1006424931 6:33958081-33958103 CTGTGGCTATGGCACTCAGGAGG - Intergenic
1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG + Intergenic
1011670987 6:89682823-89682845 CTGTGGTCCCAGCACTCAGGAGG + Intronic
1019951684 7:4378310-4378332 CTGTGGGTCATGAATTCAGGAGG + Intergenic
1020049290 7:5071481-5071503 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1021764454 7:23932756-23932778 CTGGGGGTCTCTGCCTCAGGGGG + Intergenic
1026925921 7:74193545-74193567 CTGTTGGTTGCGCACTCAGGGGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1034246855 7:149651446-149651468 ATGTGGGGCTCGAACCCAGGTGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1036199379 8:6754600-6754622 CTGTGGAGCTCGCAGTCTGGTGG + Intronic
1037619574 8:20551524-20551546 CCGTGGGTTTCACTCTCAGGAGG + Intergenic
1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG + Exonic
1040892018 8:52326999-52327021 CTGTGGGGCTCCCTCTCCGGTGG - Intronic
1054788611 9:69234086-69234108 CTGTGAGTCTCTCACAGAGGTGG - Intronic
1060648247 9:125301189-125301211 CTGTAGGCCCAGCACTCAGGAGG - Intronic
1200934763 Y:8728673-8728695 CTGTGGGGCTCTCTCTCAGGTGG - Intergenic
1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG + Intergenic
1201763765 Y:17562243-17562265 GTGTGCATCTCGCCCTCAGGAGG - Intergenic
1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG + Intergenic
1201838197 Y:18345381-18345403 TTGTGTGTCTCGCCCTCAGGGGG - Intergenic