ID: 1085769029

View in Genome Browser
Species Human (GRCh38)
Location 11:79308790-79308812
Sequence GAACAATCATTTCACTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 344}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085769023_1085769029 15 Left 1085769023 11:79308752-79308774 CCACTCTGCAGAGCCACCTCCTG 0: 1
1: 0
2: 11
3: 74
4: 476
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769025_1085769029 -1 Left 1085769025 11:79308768-79308790 CCTCCTGAGTGCGAGACCCACAG 0: 1
1: 0
2: 0
3: 23
4: 97
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769024_1085769029 2 Left 1085769024 11:79308765-79308787 CCACCTCCTGAGTGCGAGACCCA 0: 1
1: 0
2: 0
3: 3
4: 138
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769022_1085769029 16 Left 1085769022 11:79308751-79308773 CCCACTCTGCAGAGCCACCTCCT 0: 1
1: 0
2: 1
3: 37
4: 351
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769020_1085769029 24 Left 1085769020 11:79308743-79308765 CCATGCCACCCACTCTGCAGAGC 0: 1
1: 0
2: 2
3: 40
4: 567
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769026_1085769029 -4 Left 1085769026 11:79308771-79308793 CCTGAGTGCGAGACCCACAGAAC 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769021_1085769029 19 Left 1085769021 11:79308748-79308770 CCACCCACTCTGCAGAGCCACCT 0: 1
1: 0
2: 4
3: 41
4: 418
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769018_1085769029 30 Left 1085769018 11:79308737-79308759 CCCAGGCCATGCCACCCACTCTG 0: 1
1: 0
2: 5
3: 57
4: 527
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344
1085769019_1085769029 29 Left 1085769019 11:79308738-79308760 CCAGGCCATGCCACCCACTCTGC 0: 1
1: 1
2: 6
3: 50
4: 412
Right 1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG 0: 1
1: 0
2: 1
3: 40
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085769029 Original CRISPR GAACAATCATTTCACTTCTC TGG Intronic
903486584 1:23693835-23693857 CAGCAATCTTTTCATTTCTCCGG - Exonic
904405920 1:30287843-30287865 GACAAATCACTTCCCTTCTCAGG - Intergenic
905200804 1:36315322-36315344 CAACAACCATTTCAATGCTCTGG - Intronic
906697801 1:47836419-47836441 GGGCAATCATTCAACTTCTCAGG + Intronic
906796310 1:48698834-48698856 GACCAGTTATTTAACTTCTCTGG - Intronic
907149085 1:52265681-52265703 TAACAACCATTTCACATCTTTGG - Intronic
907476262 1:54707749-54707771 TAATAATCATTGCACTGCTCTGG - Intronic
907707482 1:56845394-56845416 GGACAGTCATGTGACTTCTCCGG - Intergenic
908483344 1:64565667-64565689 GAACAATTATGTCTCCTCTCAGG - Intronic
908673587 1:66576281-66576303 TTACAATTATTTCACTTCACAGG - Intronic
908794866 1:67821098-67821120 GAAGAATCATTCCAATTATCAGG - Intronic
908807121 1:67943425-67943447 AGAAATTCATTTCACTTCTCTGG - Intergenic
908971101 1:69832698-69832720 GACCAATGATGTCACTTCTAAGG + Intronic
909965398 1:81903126-81903148 GCAAAGTCATTTTACTTCTCTGG - Intronic
910519365 1:88101571-88101593 GAGCAATCAGTTAACTTCTCTGG + Intergenic
910800073 1:91136542-91136564 GTAAAATCATTTCACTTGCCTGG + Intergenic
912569175 1:110608777-110608799 GATAAGTTATTTCACTTCTCTGG + Intronic
912809579 1:112783830-112783852 GTCCAATCTTTTCACTTCCCTGG + Intergenic
913224859 1:116690026-116690048 GCAAAATCATTTTACTTCTGGGG - Intergenic
915208787 1:154290880-154290902 AAACAATGATTTCAAGTCTCTGG + Intergenic
915650396 1:157306370-157306392 GAACAGTTATTTAACCTCTCTGG + Intergenic
916288707 1:163139836-163139858 GGACAAACGTTTCACTTCTATGG + Intronic
916301130 1:163275640-163275662 AAATAACCATTTCAGTTCTCTGG - Intronic
916988013 1:170212545-170212567 GGAAAATCATTTCATCTCTCTGG - Intergenic
917596104 1:176530709-176530731 GAAAAATCATTTAAAGTCTCTGG + Intronic
917807431 1:178626319-178626341 GAAGAAGCATTTCATTTCTCAGG - Intergenic
919050889 1:192509914-192509936 AAACAATAATTTCATTTCTCTGG - Intergenic
920309189 1:205038580-205038602 GCCCAATCATTTCACCTTTCTGG + Intergenic
920330272 1:205202271-205202293 GAATACTCATGACACTTCTCAGG + Intronic
920805799 1:209232133-209232155 GAAAAGTCATTTTTCTTCTCTGG + Intergenic
921498987 1:215877122-215877144 TAAAAATCACTTAACTTCTCTGG - Intronic
922593121 1:226793764-226793786 GAACAATCATGTCACGTTTCAGG - Intergenic
923783683 1:237047942-237047964 GAACATTCCTTTCATCTCTCTGG - Intronic
1063020105 10:2118536-2118558 GAAGGATCATTTTCCTTCTCTGG + Intergenic
1065737031 10:28763634-28763656 GTACATTAATTCCACTTCTCTGG + Intergenic
1066585553 10:36930479-36930501 GTCCAATCATTTGGCTTCTCTGG + Intergenic
1068009362 10:51428512-51428534 AAACAACCATTTCATTACTCTGG + Intronic
1068177070 10:53474824-53474846 GAAAAATAAATTCACCTCTCTGG - Intergenic
1068701046 10:60019961-60019983 AAAGAGTCATTTAACTTCTCTGG + Intergenic
1068841277 10:61617073-61617095 GAAAAAGTATTTAACTTCTCTGG + Intergenic
1069293641 10:66815354-66815376 AAACAAACAATTCACTTCGCTGG + Intronic
1069437834 10:68401566-68401588 GAACAATGAATACACTTCTGTGG + Intronic
1069882368 10:71601851-71601873 GGCCAGTCACTTCACTTCTCTGG - Intronic
1071838251 10:89441391-89441413 GGACAATCACTTCCTTTCTCTGG - Intronic
1072156446 10:92728319-92728341 GTCCAATCTTTTCACTTCCCTGG + Intergenic
1072386588 10:94936661-94936683 TAATAATCATTTCATTCCTCAGG - Intergenic
1072488665 10:95881487-95881509 GAACAAAATTTTCATTTCTCTGG + Intronic
1072798171 10:98372523-98372545 GAAAAGTCACTTGACTTCTCGGG + Intergenic
1074347420 10:112700963-112700985 GAGGAATCATTTCTCTTCTGTGG + Intronic
1074353629 10:112761994-112762016 GAACAGCCATTTAACTTCTTTGG - Intronic
1074469042 10:113710479-113710501 GAACTTTCAATTCACTGCTCTGG + Intronic
1078563799 11:12396132-12396154 GACAAGTCAGTTCACTTCTCTGG - Intronic
1079173007 11:18114001-18114023 ATATTATCATTTCACTTCTCTGG + Intronic
1080287597 11:30633799-30633821 ACAGAGTCATTTCACTTCTCAGG - Intergenic
1080420085 11:32102086-32102108 GACTCGTCATTTCACTTCTCGGG + Intronic
1081021457 11:37953207-37953229 GAAAAATCATTACATTTTTCAGG - Intergenic
1083078177 11:60063305-60063327 GAAGAATCATTTCCATTATCTGG + Intronic
1083490741 11:63013672-63013694 GGACAATCATTTCCTTTCTCTGG + Intronic
1084600480 11:70142591-70142613 AAGCAAACATTGCACTTCTCGGG + Intronic
1085574918 11:77593720-77593742 GATAAGTCATTTCACTTTTCTGG - Intronic
1085769029 11:79308790-79308812 GAACAATCATTTCACTTCTCTGG + Intronic
1086941704 11:92804837-92804859 GAACAATCAATCGTCTTCTCAGG - Intronic
1087912318 11:103768217-103768239 GGAAAAGCATTTCACTTCTTAGG - Intergenic
1088231142 11:107674532-107674554 GAACAGTCATTTCACTGCAGAGG - Intergenic
1088488126 11:110360864-110360886 AAACAAACATTACACTCCTCAGG - Intergenic
1088809735 11:113383554-113383576 GAACACTGTTTTCATTTCTCTGG + Intergenic
1089021152 11:115216273-115216295 GAACAAACAAATCCCTTCTCTGG + Intronic
1089129971 11:116203787-116203809 GCTCAGTCATTTAACTTCTCAGG + Intergenic
1089846713 11:121464587-121464609 GGTGAATCATTTCACCTCTCCGG + Intronic
1090232605 11:125119418-125119440 GAAGGCTCATTTCAGTTCTCTGG + Intergenic
1090497343 11:127226580-127226602 GAGCAATCACTCCACTTCTCTGG - Intergenic
1092510146 12:9146692-9146714 TAACAATCCTTTCTCTTCTCAGG + Intergenic
1094441385 12:30480911-30480933 GAACAATCATGTTCTTTCTCTGG + Intergenic
1096228747 12:49885708-49885730 GACAAATCATTCCATTTCTCTGG + Intronic
1096240433 12:49956915-49956937 GAGAAGTCATTTCCCTTCTCTGG - Exonic
1096586503 12:52625642-52625664 GAACATAGATTTCATTTCTCTGG - Intergenic
1097506109 12:60473554-60473576 AAACAAACATTTCATATCTCAGG + Intergenic
1097639651 12:62164946-62164968 GGAAAATCATTTAATTTCTCTGG - Intronic
1097861046 12:64519024-64519046 GATCAATCATGTGACTTCTTGGG - Intergenic
1098367045 12:69714631-69714653 CAATATTTATTTCACTTCTCAGG + Intergenic
1099187410 12:79530651-79530673 GATGAATTATTTCCCTTCTCTGG + Intergenic
1100394323 12:94171499-94171521 CAACAATCATCCCATTTCTCTGG - Intronic
1100575389 12:95887265-95887287 GAACATAATTTTCACTTCTCTGG - Intronic
1101688952 12:107056661-107056683 GAACAATCTTTTGGCTTCCCTGG - Intronic
1101864000 12:108506507-108506529 GACAAGTCATTTCACATCTCTGG + Intergenic
1103184081 12:118941294-118941316 GAGAAGTCACTTCACTTCTCTGG - Intergenic
1104929975 12:132333513-132333535 GAACCAGCATTTCCCTTCACTGG - Intergenic
1107384741 13:39895796-39895818 TAATTATCATTTCACTTGTCTGG - Intergenic
1107733158 13:43368854-43368876 GGCAAATCACTTCACTTCTCTGG - Intronic
1108982111 13:56527921-56527943 GAGCAAACACTTCACTTCTGAGG + Intergenic
1109820843 13:67651812-67651834 GTACACTCATTTCAACTCTCAGG + Intergenic
1110118802 13:71854862-71854884 GAAAAATCATATCAGTTCTTTGG - Intronic
1110787616 13:79549676-79549698 TAACACACATTTTACTTCTCAGG - Intronic
1111958614 13:94784709-94784731 TAGCAATCTTTTCACTTCCCTGG - Intergenic
1112207032 13:97334852-97334874 GGAAAATCATTGAACTTCTCTGG - Intronic
1112970723 13:105258895-105258917 GAAAAGTTATGTCACTTCTCAGG - Intergenic
1113179248 13:107606862-107606884 AATCAATTATTTCACTTTTCAGG - Intronic
1113874572 13:113585773-113585795 GAAAAATCATTTTTCTTCTCTGG + Exonic
1117918823 14:60706236-60706258 GAAATATCAGTTCACCTCTCTGG - Intergenic
1118234652 14:63991375-63991397 GAACAAGAATTTAATTTCTCTGG + Intronic
1120062700 14:80002753-80002775 CCATAATCTTTTCACTTCTCTGG - Intergenic
1120248170 14:82030122-82030144 AAAAAATCACTTCACCTCTCTGG - Intergenic
1121064446 14:90949030-90949052 CAAAAAGCATTTCCCTTCTCAGG + Intronic
1121327783 14:93031579-93031601 GAGCCATCATTTCCCTTGTCTGG + Intronic
1121747554 14:96310586-96310608 GAGCAATCATCTAAATTCTCTGG + Intronic
1125600274 15:40911810-40911832 GGACTATTATTTCACTTTTCAGG + Intergenic
1126333347 15:47558076-47558098 GACACATCATTTCACTTCACTGG + Intronic
1126388025 15:48113908-48113930 GGAAAATCACTTCACTTCTTAGG - Intergenic
1126557963 15:50011078-50011100 GACCAATCACTTAACCTCTCTGG - Intronic
1126860918 15:52882308-52882330 GACAAGTCATTTCACTTCTAAGG + Intergenic
1127520411 15:59738093-59738115 ATCCAATCATTTCAGTTCTCAGG + Intergenic
1128734613 15:70046128-70046150 CAGACATCATTTCACTTCTCTGG + Intergenic
1128951182 15:71883914-71883936 GAAAAATTATTTAACTTCTCTGG + Intronic
1129139362 15:73583186-73583208 GACCAGTCACTTCCCTTCTCTGG - Intronic
1129948212 15:79560510-79560532 GAAAAATCATTTTTCTTCTCTGG - Intergenic
1131717232 15:95125556-95125578 GAAATATCATTTCATTTCACTGG + Intergenic
1133637843 16:7686707-7686729 GAAAATTCATTTCACCTGTCTGG - Intronic
1133659838 16:7905518-7905540 GCACAAGCCATTCACTTCTCTGG - Intergenic
1133890176 16:9871632-9871654 TTCCAATCAATTCACTTCTCTGG + Intronic
1137733111 16:50704019-50704041 GGACATTCATTTCACTCCACAGG - Intronic
1139048598 16:63095336-63095358 GAAGAAACCCTTCACTTCTCTGG + Intergenic
1139148801 16:64354921-64354943 AAACAATGATTTAACTTTTCTGG + Intergenic
1139192634 16:64882183-64882205 GACCAATTACTTAACTTCTCAGG - Intergenic
1139208276 16:65050633-65050655 GAACAATCCTTTGATTTTTCAGG - Intronic
1139212278 16:65091324-65091346 CAATAATCATCTCACTTTTCTGG - Intronic
1140346339 16:74216670-74216692 GAGAAGTCACTTCACTTCTCTGG + Intergenic
1142972544 17:3622632-3622654 GAACAATCATTTGCCTTTTCAGG - Intronic
1146151323 17:30475209-30475231 GGACAATAATTTCACCACTCTGG + Intergenic
1146475039 17:33156013-33156035 GAGAAATCATTTAACCTCTCTGG + Intronic
1146987570 17:37235352-37235374 GGAAAATCATTTTACCTCTCTGG + Intronic
1148389708 17:47262627-47262649 GACAAGTCACTTCACTTCTCAGG - Intronic
1149173123 17:53836691-53836713 GAATAACCATTTCTTTTCTCAGG - Intergenic
1150924238 17:69515784-69515806 GAGCAGTCACTTTACTTCTCTGG + Intronic
1151235063 17:72713922-72713944 GAAATGTCATTTCACTTCTCTGG - Intronic
1151267981 17:72971359-72971381 GAAAAACCAGTTTACTTCTCAGG + Intronic
1151306577 17:73266545-73266567 TAACAATCACTCAACTTCTCTGG - Intergenic
1153193935 18:2572216-2572238 TGACAATCCTTTTACTTCTCTGG - Intronic
1155498145 18:26462560-26462582 GAAGGATCATTTCAGTTCTCTGG - Intronic
1156492344 18:37503673-37503695 GATAAATCTCTTCACTTCTCTGG + Intronic
1157129860 18:44996715-44996737 CAAGACTCATTTCACCTCTCAGG - Intronic
1157223409 18:45842616-45842638 GGACACTCTCTTCACTTCTCTGG + Intronic
1159675462 18:71278860-71278882 AAACATACATTTCACTTCTAAGG + Intergenic
1161688596 19:5717515-5717537 GAAGAATCATCTCTCTGCTCAGG + Intronic
1162868756 19:13569571-13569593 GAAGAGTCACTTCACCTCTCTGG - Intronic
1164232814 19:23305949-23305971 GTAGAATTATTTCTCTTCTCTGG - Intronic
1166443894 19:42841913-42841935 GTATAATCATTTCACCTCTTTGG - Intronic
1166451337 19:42904581-42904603 GTATAATCATTTCACCTCTTTGG - Intronic
1166463575 19:43012578-43012600 GTATAATCATTTCACCTCTTTGG - Intronic
1166469725 19:43069152-43069174 GTATAATCATTTCACCTCTTTGG - Intronic
1167385188 19:49158730-49158752 GGCAAATCATTTCACCTCTCTGG + Intronic
1167897903 19:52596279-52596301 GAACACTCATTACACTTGTAAGG - Intronic
1167905135 19:52653716-52653738 GAACACTCATTACACTTGTAAGG + Intronic
924994553 2:346090-346112 GTACAAGTCTTTCACTTCTCTGG + Intergenic
925699675 2:6623249-6623271 AAACAATCATTTCAGAGCTCTGG - Intergenic
926457176 2:13081152-13081174 GGACAATCATTTCTCTACTTGGG - Intergenic
928630573 2:33187496-33187518 AAACAATCATTTAACCTCACTGG + Intronic
930260304 2:49139053-49139075 GACAAATCATTTCATTTCACTGG + Intronic
931202120 2:60107557-60107579 GGAAAATGATTTCACTTCTCTGG - Intergenic
931823878 2:65979351-65979373 AAATAATTAATTCACTTCTCTGG - Intergenic
933620822 2:84539217-84539239 AAACAAGCATTTCTCTTCCCTGG + Intronic
934169903 2:89531822-89531844 GGAAAATTATTTAACTTCTCTGG + Intergenic
934280205 2:91606130-91606152 GGAAAATTATTTAACTTCTCTGG + Intergenic
935048671 2:99504829-99504851 GACAAATAATTTAACTTCTCTGG - Intergenic
935283830 2:101545774-101545796 GAACATTCCCTTCACCTCTCTGG + Intergenic
935366735 2:102300676-102300698 GAACTTCCATTTCTCTTCTCTGG + Intergenic
935796570 2:106647349-106647371 GATCAATCATTTTGCTTCCCTGG - Intergenic
936406945 2:112213373-112213395 GGACAGTCATTTAACATCTCGGG + Exonic
936454917 2:112665673-112665695 GTTCAATCTTTTCACTTCCCTGG - Intergenic
936537612 2:113324249-113324271 GAACAATAATCTCTCTTTTCAGG - Intergenic
937149051 2:119673378-119673400 CAACAATCATTTCATTTTCCTGG + Intergenic
937336397 2:121064928-121064950 GAAAAATAATTTCTTTTCTCTGG - Intergenic
937348995 2:121147974-121147996 GAACATTTTTTTCACTTCCCTGG - Intergenic
937392832 2:121506289-121506311 GAACTATCATTCCACCTATCTGG + Intronic
937880504 2:126860924-126860946 AAACAATCATTTAAAGTCTCTGG + Intergenic
938803424 2:134784557-134784579 GGACAACCACTTCACCTCTCTGG - Intergenic
939534608 2:143412094-143412116 ACAGAATCATGTCACTTCTCTGG - Intronic
940383113 2:153038859-153038881 GTACAAGTTTTTCACTTCTCAGG + Intergenic
940669885 2:156654384-156654406 GTACAATCATTTCAATGCTTAGG + Intergenic
940887320 2:159000984-159001006 GAGCAATTACTTCACCTCTCTGG - Intronic
941340969 2:164302749-164302771 AAACAATCATTTAAAGTCTCTGG + Intergenic
941405733 2:165084841-165084863 GAGCAATTATTTAAGTTCTCTGG - Intergenic
942427393 2:175874370-175874392 ATATAATCATTTGACTTCTCTGG + Intergenic
942726015 2:179008859-179008881 GCACAATCAGGTCACTCCTCAGG + Intronic
944860580 2:203812127-203812149 GACAACTCATTTCACATCTCGGG + Intergenic
945406605 2:209456414-209456436 GAACCATCATTTTACTACTCAGG + Intronic
948233031 2:236365718-236365740 GACCAACCTTTTCACCTCTCTGG - Intronic
948356719 2:237384148-237384170 GCAGAATCATTTCATTTCTCTGG + Intronic
1168812994 20:718499-718521 GAGAAATCATGTCACCTCTCTGG + Intergenic
1168816919 20:744060-744082 AAACAATCATTTGAAGTCTCTGG + Intergenic
1170264443 20:14449244-14449266 GAACCATCTATTCATTTCTCTGG - Intronic
1170264856 20:14454682-14454704 GACAAATCACTTAACTTCTCTGG - Intronic
1170787495 20:19480262-19480284 GAGAAGTCATTTCACCTCTCTGG + Intronic
1170860045 20:20094364-20094386 TATGAATCATTTCACTTCTCAGG - Intronic
1171171390 20:23018350-23018372 GAAAAATCACTTCACCTCTTAGG + Intergenic
1171293585 20:23997084-23997106 TAGCCATCATTTCATTTCTCCGG + Intergenic
1172023637 20:31933587-31933609 GAAAAGCCATTTCACTTCCCTGG - Intronic
1172381909 20:34501409-34501431 GAACAAATATTTGACTTCTTAGG - Intronic
1173758063 20:45535477-45535499 GACCACTCATTTTACCTCTCTGG + Intronic
1174262919 20:49310283-49310305 GGAGAGTCATTTCACCTCTCTGG - Intergenic
1175395264 20:58653218-58653240 GAACATTCATTTCACCTCTTAGG + Intronic
1177527173 21:22309462-22309484 GAACAAAAATTCCACATCTCTGG + Intergenic
1177744402 21:25193851-25193873 GAAAAGACATTTCACTTCTTTGG + Intergenic
1178571839 21:33745451-33745473 GAATAACCATTTCAGTGCTCTGG + Intronic
1179203613 21:39251400-39251422 TAAAAATCATTTTTCTTCTCTGG + Intronic
1181674540 22:24443036-24443058 GAGCAATCATGTAACCTCTCTGG - Intergenic
951778293 3:26334715-26334737 CAACAATGCTTTCAGTTCTCTGG + Intergenic
952041551 3:29267644-29267666 TAAAAATCATATCCCTTCTCTGG + Intergenic
952206697 3:31187474-31187496 GGTAAATCATTTCACCTCTCTGG - Intergenic
952388305 3:32859182-32859204 GAAAAATAATTTCAAGTCTCAGG - Intronic
952912930 3:38205877-38205899 AAACAACCATTTCAGTGCTCTGG - Intronic
952928553 3:38341263-38341285 GTCCAATCTTTTCACTTCCCTGG + Intergenic
954283233 3:49599660-49599682 GAACAATCATTTAAAGTCTCTGG - Intronic
955879324 3:63526999-63527021 GAACAAACACTGCTCTTCTCTGG - Intronic
957849682 3:85791201-85791223 GAGCATTCATTGCACTTCTCTGG + Intronic
958107833 3:89100630-89100652 GAATAATGTTTTCACTTTTCTGG + Intergenic
959185220 3:103038383-103038405 GGACAATAATTTGACTTCTTTGG - Intergenic
960666009 3:120109468-120109490 GAATATTCACCTCACTTCTCTGG - Intergenic
960693244 3:120369440-120369462 GGACAATTATCTCACCTCTCTGG - Intergenic
960788584 3:121400802-121400824 GAATAATCATTTCATAGCTCTGG + Intronic
961123670 3:124396525-124396547 GGACAGTCATTTAACCTCTCTGG + Intronic
961435581 3:126914176-126914198 GAGAAGTCATTTCACCTCTCCGG + Intronic
962452119 3:135528672-135528694 GAACTTTGATTTCACTTCTCAGG + Intergenic
962540985 3:136381784-136381806 GAAAAATTATTTTACATCTCAGG + Intronic
964418204 3:156472144-156472166 TAACAGTCGCTTCACTTCTCAGG + Intronic
964505310 3:157392524-157392546 GTACAATCATTTGGCTTCCCTGG + Intronic
965574287 3:170202754-170202776 ACAGAGTCATTTCACTTCTCTGG + Intergenic
966195294 3:177307841-177307863 GCATAATCATTTCAAATCTCGGG + Intergenic
966234740 3:177687971-177687993 GAACAATGTTTTCAATTTTCTGG + Intergenic
966771112 3:183504119-183504141 AATCAATCATTTTCCTTCTCTGG - Intronic
967095628 3:186175101-186175123 GAAAAATCATTTCCCTCCTCAGG + Intronic
967293688 3:187945656-187945678 GAACATTCATTTCCCCTCTTTGG - Intergenic
967310070 3:188097454-188097476 AAAGAATTCTTTCACTTCTCTGG + Intergenic
967354018 3:188547656-188547678 GAGCAGTCATTTCACATTTCTGG - Intronic
967859433 3:194140616-194140638 GATAAGTCATTTCCCTTCTCTGG + Intergenic
968339407 3:197942144-197942166 TAGCAATCATTTCACTTTTTTGG - Intronic
970046023 4:11855271-11855293 GTCCAATCTTTTCACTTCCCTGG - Intergenic
971032168 4:22651080-22651102 AAATAATCATTTTAATTCTCTGG + Intergenic
971575209 4:28264095-28264117 GGAAAATCATTTAACCTCTCTGG - Intergenic
971678266 4:29664159-29664181 ACACAATAATATCACTTCTCAGG + Intergenic
971787790 4:31126970-31126992 GAGCAATGAATTCACTTCACTGG - Intronic
972114582 4:35614595-35614617 GAGAAATAATTTCAATTCTCAGG - Intergenic
972408898 4:38772084-38772106 CAAACATCATGTCACTTCTCTGG - Intergenic
972867968 4:43257440-43257462 GAACTGGCATTTCACTTTTCAGG + Intergenic
974433031 4:61822999-61823021 GAACAGTGATTTCTCTTCTCTGG - Intronic
974498753 4:62669091-62669113 GAACAAACATTTATCTTCCCAGG - Intergenic
975721098 4:77249442-77249464 AAACACTCACTACACTTCTCAGG + Intronic
978402600 4:108346755-108346777 GGTCAATCATTTAACTTCTGTGG - Intergenic
978768342 4:112428290-112428312 GAACATCCTTGTCACTTCTCTGG - Intronic
979395454 4:120182877-120182899 GTAGAAACATTTCACTTCTTTGG - Intergenic
979540569 4:121876446-121876468 GACAAACCATTTAACTTCTCTGG - Intergenic
979943394 4:126792483-126792505 GAACAAGCATTGCCCTTCTGGGG + Intergenic
981690746 4:147506017-147506039 GAACAAAATTTTCACTTCTCTGG - Intronic
981895442 4:149793987-149794009 GAACACTCATTACAGTTTTCTGG - Intergenic
982545524 4:156727807-156727829 GAAAATTCATTTCACATCTTGGG - Intergenic
983168430 4:164508009-164508031 TGAGCATCATTTCACTTCTCTGG + Intergenic
983828242 4:172292150-172292172 TCACAATCATTACACCTCTCAGG + Intronic
984643786 4:182199161-182199183 GAAGAATCATTGCACATTTCAGG + Intronic
985845178 5:2339259-2339281 GAACACTCATCTCCTTTCTCTGG + Intergenic
986334762 5:6745757-6745779 AATCAATCCTTTCACTTTTCCGG + Intronic
986444933 5:7812973-7812995 GTAGAGTCATTTAACTTCTCTGG - Intronic
986990140 5:13542862-13542884 AAATAATAATTTCACTTCTAAGG + Intergenic
988151388 5:27386456-27386478 GAAAAATCAAATCAATTCTCAGG - Intergenic
988678149 5:33455596-33455618 TAGCAATGATTTCTCTTCTCTGG + Exonic
989437669 5:41433861-41433883 GAAAAATCATATCACTTCAAGGG - Intronic
989444646 5:41512921-41512943 GGACAATCATGTAATTTCTCTGG + Intergenic
989485564 5:41987357-41987379 GAAAAATTATTTAACTTCCCAGG - Intergenic
990377325 5:55184739-55184761 GAAAAATCATTTCTCTTTTGGGG - Intergenic
990519318 5:56562922-56562944 GTATAATCGTTTCACCTCTCTGG + Intronic
990640884 5:57782193-57782215 CAACAATTATTTCCCTCCTCTGG + Intergenic
990741014 5:58912808-58912830 GAATTATCATTCCACATCTCTGG + Intergenic
992260273 5:74963131-74963153 GACCAGCAATTTCACTTCTCAGG - Intergenic
993137530 5:83989114-83989136 GAACCATGATTCCACTTCTAGGG - Intronic
993679773 5:90861812-90861834 AAACAATTATTTCAATTATCAGG - Intronic
993942422 5:94075925-94075947 GACAAATTATTTAACTTCTCTGG + Intronic
995225725 5:109698640-109698662 GAAAAAGCATTTAATTTCTCTGG - Intronic
995376424 5:111479583-111479605 TAGCAGTCATTTCACCTCTCTGG - Intronic
995641999 5:114267489-114267511 GAAAAATAATTTCAACTCTCAGG + Intergenic
995914984 5:117234383-117234405 GTACAATCTTTTGACTTCCCTGG + Intergenic
997009411 5:129859253-129859275 GAACCAACATTTCAGTTCCCTGG + Intergenic
997929535 5:138060935-138060957 GTCAAATCATTTCCCTTCTCAGG - Intergenic
998238873 5:140424650-140424672 GATCAATCATATCACTCCTTTGG - Intronic
998503261 5:142652097-142652119 GAGCAATTATTTAACTTCTCTGG - Intronic
998709925 5:144812428-144812450 GAACATTCCTCTCACTTTTCTGG + Intergenic
998928611 5:147155801-147155823 GAACAAGGGTTTGACTTCTCTGG + Intergenic
999870864 5:155749381-155749403 GAACTATCAGATTACTTCTCTGG + Intergenic
1001231044 5:169988805-169988827 GGAGAGTCATTTCACCTCTCTGG - Intronic
1001302721 5:170548431-170548453 GAATTAAAATTTCACTTCTCCGG + Intronic
1001763765 5:174228477-174228499 GAACATTCATTCCACTGCCCTGG - Intronic
1002093047 5:176816060-176816082 GACAAATCATTTAACCTCTCTGG + Intronic
1002720394 5:181257061-181257083 GAACAAAGATTTCACTTATTGGG - Exonic
1002793751 6:453704-453726 GAACCAACCTTTCACTTCTGGGG + Intergenic
1003430678 6:6034553-6034575 GAAAAATCTTTCCACTTCTATGG - Intergenic
1003989006 6:11467172-11467194 GAACAATCATATCCCTTCTTTGG + Intergenic
1005144405 6:22671430-22671452 CAACAATCATAGCTCTTCTCTGG + Intergenic
1005803728 6:29453315-29453337 AAACAATCATTTCAGGTGTCTGG + Intronic
1007208298 6:40170485-40170507 CAACAATCATTTCTCTTCCAGGG + Intergenic
1007831241 6:44640046-44640068 GGAAAATCACTTCACTCCTCTGG - Intergenic
1008296025 6:49778582-49778604 GGCAAATCATTTCACTTCTCTGG - Intergenic
1008599320 6:53074936-53074958 GAACATAATTTTCACTTCTCTGG + Intronic
1009167184 6:60355494-60355516 AAAGAATCCTTTCACTTGTCTGG + Intergenic
1009733135 6:67635709-67635731 GATCATACATTTCATTTCTCTGG - Intergenic
1010922577 6:81702810-81702832 GGACAATCATTTAATTTCTCTGG - Intronic
1011642333 6:89427334-89427356 GAACATAGTTTTCACTTCTCTGG - Intergenic
1012275801 6:97274236-97274258 GAACAATCATGCCACTACTGTGG + Intronic
1012817162 6:104038767-104038789 TTACAATGATTTGACTTCTCTGG - Intergenic
1012857831 6:104523917-104523939 ATCCAATCATTTCACTTCTCTGG - Intergenic
1015735996 6:136400683-136400705 GAAGCATCATTTCACTTCTTTGG - Intronic
1015786784 6:136926854-136926876 AAACAATCATTCCACTTATCTGG - Intergenic
1016155832 6:140807976-140807998 AAACAATCATTTAAAGTCTCAGG + Intergenic
1018921016 6:168174372-168174394 GAATAATGATTTTATTTCTCAGG + Intergenic
1021177698 7:17469215-17469237 CAACAATCATTTGTCTTTTCTGG + Intergenic
1021819547 7:24482708-24482730 GTACAAACATTTCAATTCTGAGG - Intergenic
1023094319 7:36644849-36644871 GAATCATCATTTTACTTCCCAGG - Intronic
1023325583 7:39052264-39052286 TTACTATCATTTCATTTCTCTGG - Intronic
1024991340 7:55236760-55236782 AAACGATCATTTTATTTCTCAGG + Intronic
1027720393 7:81734453-81734475 GAACATTAATTTCACTTTGCTGG + Intronic
1030542922 7:110855454-110855476 GAGAAGTCATCTCACTTCTCAGG + Intronic
1032752099 7:134851760-134851782 GAAGTATCATGTCACTTCTGGGG - Intronic
1033123743 7:138689060-138689082 GAACACTCATGACACTTCCCAGG + Intronic
1033385702 7:140873097-140873119 AAACAACCATTTCAGTGCTCTGG + Intronic
1033853945 7:145534192-145534214 GAACACTCATATCACTCCTGTGG - Intergenic
1034163858 7:149011334-149011356 TCACAGTCATTTCACTCCTCAGG + Intronic
1036475917 8:9093155-9093177 GACCAATCTTTTGACTTCCCTGG + Intronic
1037097396 8:15001854-15001876 GAACAAGCTTTTCACTTCTCTGG - Intronic
1037312570 8:17572292-17572314 GACCAACAATTTCACTGCTCTGG + Intergenic
1037568916 8:20141970-20141992 GACAAGTCATTTCACGTCTCTGG - Intergenic
1037600555 8:20390378-20390400 GAGAAGTCATTTCAGTTCTCAGG - Intergenic
1037601519 8:20399971-20399993 GAAAAATCATTTTATTTCTTCGG + Intergenic
1038259810 8:25982972-25982994 GTACAATAATCTCAATTCTCTGG + Intronic
1038329462 8:26596710-26596732 GGCAAGTCATTTCACTTCTCTGG - Intronic
1038745640 8:30252521-30252543 GCACAATCATTTGATTTTTCTGG + Intergenic
1039325686 8:36483111-36483133 GAAAAATCATTTCAGTTATCTGG + Intergenic
1039769204 8:40665812-40665834 GGACAGTCACTTCACGTCTCTGG + Intronic
1039838710 8:41278399-41278421 GTAAAATCATTTTACTTCTCTGG + Intronic
1041049850 8:53923611-53923633 AAACAATCATTTAAAGTCTCTGG - Intronic
1041195612 8:55398604-55398626 GTTCAATCACTTCACCTCTCTGG + Intronic
1042557763 8:70047964-70047986 GAAAAATCATTTGATTTCTGAGG - Intergenic
1042922420 8:73932949-73932971 AAGCAACCATTTCACTTCTCAGG + Intergenic
1043378873 8:79681621-79681643 GTTCAATCTTTTGACTTCTCTGG + Intergenic
1043392293 8:79803543-79803565 AAACAAGCATTTCACCTTTCTGG - Intergenic
1043453321 8:80390632-80390654 CAACAAATACTTCACTTCTCTGG - Intergenic
1044520961 8:93198838-93198860 GAACAAAGATTTCTCTTCTGTGG + Intergenic
1046478766 8:114785630-114785652 AAACAATCATTTCATTCCTCAGG + Intergenic
1047420981 8:124708000-124708022 GGGAAATCATTTCACTTCTCAGG + Intronic
1047688917 8:127330734-127330756 GGATCATCATTTCACTTCACTGG + Intergenic
1047769056 8:128015974-128015996 CTACAATCATTTCACTTGCCAGG + Intergenic
1047784347 8:128139229-128139251 GAACAATGACTTCACATCTTAGG - Intergenic
1047948986 8:129912469-129912491 GAACCAACCTTGCACTTCTCAGG - Intronic
1047997895 8:130354241-130354263 GAGAAATCATTTCATCTCTCTGG + Intronic
1049843647 8:144789471-144789493 GAACACTCATTTCACGTATCAGG - Intergenic
1050705490 9:8391996-8392018 GAATAATGATTGCACTTCCCAGG + Intronic
1052519562 9:29528232-29528254 GAACAAACATTTGACTTATTTGG + Intergenic
1053320607 9:37095243-37095265 GAAAAATCCTTTCTCTTCTTTGG - Intergenic
1053463119 9:38285992-38286014 GTACAATCTTTTGACTTCCCTGG + Intergenic
1054384733 9:64537427-64537449 GTTCAATCATTTAGCTTCTCTGG + Intergenic
1054902649 9:70386240-70386262 GAAAACTCAGTTCACTTTTCTGG + Exonic
1056461439 9:86813055-86813077 GAAAAATCATTGCACTTTTCAGG - Intergenic
1057064451 9:92035717-92035739 GAACAATTATTCCATGTCTCTGG + Intronic
1057279241 9:93698370-93698392 GAACACTCATGTCAATTCCCAGG - Intergenic
1057769736 9:97957251-97957273 GGCCAGTCATTTCACCTCTCTGG + Intergenic
1057875027 9:98747358-98747380 TAACAGTCATTTTACTTTTCTGG + Intronic
1058065420 9:100543607-100543629 GTCCAATCATTTGACTTCCCTGG + Intronic
1058387572 9:104456683-104456705 TAACCATCATTTAACTTATCTGG + Intergenic
1058645309 9:107126739-107126761 ACACAATCATTCCATTTCTCTGG + Intergenic
1059532141 9:115045084-115045106 GAAAAATCATTTCACCATTCTGG + Intronic
1060239306 9:121889184-121889206 GTAAAATTACTTCACTTCTCTGG - Intronic
1060873820 9:127065478-127065500 CAACTATCATTTCACTACTTTGG - Intronic
1062316529 9:135970002-135970024 GGGCAATCACTTAACTTCTCTGG + Intergenic
1062415622 9:136448032-136448054 GAAAAATCATTACAATTCTTCGG + Intronic
1062571945 9:137189778-137189800 TAACAACCTTCTCACTTCTCTGG + Intronic
1188210123 X:27413492-27413514 TAACAGTTATTTCACTTCTCAGG - Intergenic
1188550483 X:31358958-31358980 GAACAATCATTTATCTTCCTAGG - Intronic
1189002706 X:36963468-36963490 GAAAAATCATTTTTCTTCTCTGG - Intergenic
1189141903 X:38615989-38616011 GAAAAGTCATTTGACCTCTCTGG + Intronic
1189660218 X:43288515-43288537 AAACCACCATTTCAGTTCTCTGG + Intergenic
1190741008 X:53288772-53288794 GCAGAATCACTTAACTTCTCTGG - Intronic
1191900778 X:66038993-66039015 GAAAATCCATCTCACTTCTCAGG + Intronic
1192303776 X:69935846-69935868 AAACAAGCATTACACTCCTCAGG + Intronic
1193450293 X:81657391-81657413 GCAGAAACATTTTACTTCTCTGG + Intergenic
1194644299 X:96439868-96439890 GAAAAGTCAATTCATTTCTCTGG + Intergenic
1195494225 X:105511152-105511174 GGCAAATCATTTCACTTATCAGG + Intronic
1195749688 X:108151307-108151329 GAACCATTCTTTCACTACTCTGG + Intronic
1196375960 X:115032708-115032730 GGAACATCATTTAACTTCTCTGG - Intergenic
1198052562 X:132962829-132962851 GAATAGTCATCTCACTTCTTTGG + Intergenic
1199439824 X:147855451-147855473 AAAGAATTAATTCACTTCTCTGG + Intergenic
1200949566 Y:8881347-8881369 GAACATTCATCTCACTTGTTTGG + Intergenic