ID: 1085769030

View in Genome Browser
Species Human (GRCh38)
Location 11:79308791-79308813
Sequence AACAATCATTTCACTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 10, 3: 71, 4: 500}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085769021_1085769030 20 Left 1085769021 11:79308748-79308770 CCACCCACTCTGCAGAGCCACCT 0: 1
1: 0
2: 4
3: 41
4: 418
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769022_1085769030 17 Left 1085769022 11:79308751-79308773 CCCACTCTGCAGAGCCACCTCCT 0: 1
1: 0
2: 1
3: 37
4: 351
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769023_1085769030 16 Left 1085769023 11:79308752-79308774 CCACTCTGCAGAGCCACCTCCTG 0: 1
1: 0
2: 11
3: 74
4: 476
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769019_1085769030 30 Left 1085769019 11:79308738-79308760 CCAGGCCATGCCACCCACTCTGC 0: 1
1: 1
2: 6
3: 50
4: 412
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769025_1085769030 0 Left 1085769025 11:79308768-79308790 CCTCCTGAGTGCGAGACCCACAG 0: 1
1: 0
2: 0
3: 23
4: 97
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769024_1085769030 3 Left 1085769024 11:79308765-79308787 CCACCTCCTGAGTGCGAGACCCA 0: 1
1: 0
2: 0
3: 3
4: 138
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769020_1085769030 25 Left 1085769020 11:79308743-79308765 CCATGCCACCCACTCTGCAGAGC 0: 1
1: 0
2: 2
3: 40
4: 567
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500
1085769026_1085769030 -3 Left 1085769026 11:79308771-79308793 CCTGAGTGCGAGACCCACAGAAC 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG 0: 1
1: 0
2: 10
3: 71
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085769030 Original CRISPR AACAATCATTTCACTTCTCT GGG Intronic
901416518 1:9120329-9120351 AACAAGCAGGTCCCTTCTCTGGG + Intronic
903529013 1:24015270-24015292 ACAAGTCATTTCACCTCTCTCGG - Intergenic
905826086 1:41027130-41027152 ACCAGTCATTCCCCTTCTCTTGG - Intergenic
906013224 1:42549329-42549351 AATAGTCATTTCAGTTTTCTTGG - Intronic
906796309 1:48698833-48698855 ACCAGTTATTTAACTTCTCTGGG - Intronic
907476261 1:54707748-54707770 AATAATCATTGCACTGCTCTGGG - Intronic
907901364 1:58744363-58744385 AACATCCATTTCATTTCTTTTGG + Intergenic
907929358 1:58984869-58984891 TACAATCATTTCCCCACTCTTGG - Intergenic
908745105 1:67368994-67369016 AACAATCATTACACCTGTCTAGG + Intronic
909564095 1:77035534-77035556 AACATTCAGCTGACTTCTCTGGG - Intronic
909741961 1:79039983-79040005 AAGAATCATTTAACTTTTTTTGG - Intergenic
909750546 1:79155190-79155212 AACAATCTTTTAACTTCTCTAGG + Intergenic
909965397 1:81903125-81903147 CAAAGTCATTTTACTTCTCTGGG - Intronic
910519366 1:88101572-88101594 AGCAATCAGTTAACTTCTCTGGG + Intergenic
910641262 1:89465189-89465211 AAAAGTCAGTTCACCTCTCTAGG + Intergenic
910800074 1:91136543-91136565 TAAAATCATTTCACTTGCCTGGG + Intergenic
912569176 1:110608778-110608800 ATAAGTTATTTCACTTCTCTGGG + Intronic
912809580 1:112783831-112783853 TCCAATCTTTTCACTTCCCTGGG + Intergenic
913319617 1:117579076-117579098 AACAATCACTTAACTTTTCCTGG + Intergenic
913626608 1:120665837-120665859 AACTGTCATGTCACATCTCTAGG - Intergenic
915758195 1:158283921-158283943 AACAATCACTTCCCTCCTCCAGG + Intergenic
915943806 1:160135683-160135705 AAGAATCATTCCACAACTCTAGG + Intronic
916288708 1:163139837-163139859 GACAAACGTTTCACTTCTATGGG + Intronic
916988012 1:170212544-170212566 GAAAATCATTTCATCTCTCTGGG - Intergenic
917017733 1:170552813-170552835 TAAACTCATTTCACTTCTCCTGG + Exonic
917075419 1:171199687-171199709 GTGATTCATTTCACTTCTCTGGG + Intronic
917460967 1:175228802-175228824 AAAAATTATTTCAATTCTCTAGG + Intergenic
917471775 1:175331853-175331875 GCCAATCATTTCACCTCTCTTGG - Intronic
917545724 1:175965545-175965567 GAAATTCATTTCACTTATCTGGG + Intronic
917614876 1:176732373-176732395 AAAAATCATATTACCTCTCTGGG + Intronic
917739629 1:177950103-177950125 GAAAATCATTTCTCTTTTCTTGG + Intronic
917807430 1:178626318-178626340 AAGAAGCATTTCATTTCTCAGGG - Intergenic
917875917 1:179286866-179286888 AACTATCATTACACTTCTGGTGG + Intergenic
919015028 1:192021601-192021623 AAAAATCGCTTCAATTCTCTTGG + Intergenic
919554476 1:199032989-199033011 GTCAATCATTTCGCCTCTCTGGG - Intergenic
920249185 1:204611328-204611350 AACAATCAGTTCTCTTTTGTTGG - Intergenic
920290543 1:204919976-204919998 AACAATCATATAACCTTTCTTGG - Intronic
920293515 1:204941165-204941187 ACCAGTCACTTCCCTTCTCTCGG + Intronic
920805800 1:209232134-209232156 AAAAGTCATTTTTCTTCTCTGGG + Intergenic
921498986 1:215877121-215877143 AAAAATCACTTAACTTCTCTGGG - Intronic
922243386 1:223771945-223771967 ATGACTCATTTCAGTTCTCTTGG + Intronic
922415184 1:225415013-225415035 AGAAATCATTGCACTTGTCTAGG - Intronic
922593120 1:226793763-226793785 AACAATCATGTCACGTTTCAGGG - Intergenic
922629234 1:227087743-227087765 AACAATCATTTCAGAAGTCTTGG - Intronic
923930600 1:238691479-238691501 AACAATCATTCTATTTATCTAGG - Intergenic
1063205170 10:3824277-3824299 AACATTGATTTCATTTTTCTAGG + Intergenic
1064646848 10:17468513-17468535 AAGAATCATTTCTCTTCCCACGG - Intergenic
1065062583 10:21920345-21920367 AAAAATTATTACACTTTTCTTGG - Intronic
1065084740 10:22163495-22163517 AACAATCAGTTCTCTTTGCTGGG + Intergenic
1065737032 10:28763635-28763657 TACATTAATTCCACTTCTCTGGG + Intergenic
1066340650 10:34529680-34529702 AATAATATTTTCATTTCTCTAGG - Intronic
1067176596 10:43954139-43954161 AACAATGATTTAAAGTCTCTGGG - Intergenic
1068112770 10:52699635-52699657 ATGAATCAGTTTACTTCTCTTGG + Intergenic
1068177069 10:53474823-53474845 AAAAATAAATTCACCTCTCTGGG - Intergenic
1068297280 10:55088802-55088824 ATAAATCATTTCAGTTCTTTTGG - Intronic
1068302764 10:55166339-55166361 AACAGGTATTTCACTTCTCTAGG + Intronic
1068701047 10:60019962-60019984 AAGAGTCATTTAACTTCTCTGGG + Intergenic
1068841278 10:61617074-61617096 AAAAAGTATTTAACTTCTCTGGG + Intergenic
1069269589 10:66508869-66508891 TACAATGATTTCCCTTCTTTGGG + Intronic
1069882367 10:71601850-71601872 GCCAGTCACTTCACTTCTCTGGG - Intronic
1071302740 10:84268876-84268898 AACTATCATTTTAATTCTCCTGG - Intergenic
1071838250 10:89441390-89441412 GACAATCACTTCCTTTCTCTGGG - Intronic
1072156447 10:92728320-92728342 TCCAATCTTTTCACTTCCCTGGG + Intergenic
1072488666 10:95881488-95881510 AACAAAATTTTCATTTCTCTGGG + Intronic
1073409155 10:103325205-103325227 TAAAAATATTTCACTTCTCTAGG + Intronic
1074347421 10:112700964-112700986 AGGAATCATTTCTCTTCTGTGGG + Intronic
1074824554 10:117205236-117205258 TACAATCAGTTCACTGCACTTGG - Intronic
1076942756 10:133620819-133620841 AACATACGTTTCATTTCTCTTGG - Intergenic
1078563798 11:12396131-12396153 ACAAGTCAGTTCACTTCTCTGGG - Intronic
1078710375 11:13785369-13785391 AAAATTCTTTTCACTTCTCTAGG + Intergenic
1079296406 11:19238801-19238823 CCTAATCATTTTACTTCTCTGGG - Intronic
1079497238 11:21059453-21059475 AAGAATCTTTGCTCTTCTCTTGG + Intronic
1080246625 11:30186322-30186344 AAAAGTCATTTCACTTCTCATGG + Intergenic
1080287596 11:30633798-30633820 CAGAGTCATTTCACTTCTCAGGG - Intergenic
1080418258 11:32089646-32089668 AACTATCGTTTCAGTTTTCTAGG + Intronic
1080567000 11:33519423-33519445 AAGAAGCATTTGATTTCTCTTGG + Intergenic
1080757876 11:35219639-35219661 AACTAACATGGCACTTCTCTGGG - Intronic
1081412313 11:42774275-42774297 AACAATGATTTCAAATCTCTTGG - Intergenic
1081673457 11:44954700-44954722 GCCAGTGATTTCACTTCTCTAGG + Intergenic
1082920597 11:58488428-58488450 AACATACATTTCAATTCTTTTGG - Intergenic
1083078178 11:60063306-60063328 AAGAATCATTTCCATTATCTGGG + Intronic
1083243382 11:61406633-61406655 AACAGTCATTTGACTTGTGTAGG - Intronic
1083490742 11:63013673-63013695 GACAATCATTTCCTTTCTCTGGG + Intronic
1085574917 11:77593719-77593741 ATAAGTCATTTCACTTTTCTGGG - Intronic
1085711274 11:78831084-78831106 GCAAGTCATTTCACTTCTCTAGG - Intronic
1085769030 11:79308791-79308813 AACAATCATTTCACTTCTCTGGG + Intronic
1086267226 11:85015091-85015113 AGCATTCATTTCAGTGCTCTTGG - Intronic
1086529850 11:87772095-87772117 ATCATGCATTTCACTTCTCTAGG - Intergenic
1087250677 11:95895760-95895782 AAAAATATTTTCATTTCTCTTGG - Intronic
1087251117 11:95901531-95901553 ACCATTTACTTCACTTCTCTGGG - Intronic
1088349864 11:108873664-108873686 ATCAGTCATTTAACCTCTCTGGG - Intronic
1088809736 11:113383555-113383577 AACACTGTTTTCATTTCTCTGGG + Intergenic
1089057951 11:115602200-115602222 ACAAACCATGTCACTTCTCTAGG + Intergenic
1089618003 11:119706014-119706036 AACAAGCATCTCTCTTGTCTTGG - Intronic
1089790405 11:120939045-120939067 ACTAGTCACTTCACTTCTCTAGG - Intronic
1091042274 11:132292845-132292867 AACAATTATTTTTCTTCACTAGG - Intronic
1091142956 11:133251802-133251824 AAGAGGCATTTCACTACTCTAGG - Intronic
1091865739 12:3834533-3834555 TTCAATCAGTTCTCTTCTCTCGG - Intronic
1092510147 12:9146693-9146715 AACAATCCTTTCTCTTCTCAGGG + Intergenic
1093590628 12:20897760-20897782 AAAGATAATTTCATTTCTCTTGG + Intronic
1094153985 12:27318078-27318100 AAGACTCATTTCACTTTTGTGGG + Intronic
1094441386 12:30480912-30480934 AACAATCATGTTCTTTCTCTGGG + Intergenic
1095990805 12:48033368-48033390 AACAAACATTTTACTTCTTTTGG - Intergenic
1096282595 12:50269340-50269362 AACATTTATTTAACTTCTTTGGG - Intronic
1096586502 12:52625641-52625663 AACATAGATTTCATTTCTCTGGG - Intergenic
1097582780 12:61479643-61479665 AACATTCATTTCACTTTCTTTGG - Intergenic
1097616396 12:61889115-61889137 AATAATCATGTTACTTCTATTGG - Intronic
1097639650 12:62164945-62164967 GAAAATCATTTAATTTCTCTGGG - Intronic
1098367046 12:69714632-69714654 AATATTTATTTCACTTCTCAGGG + Intergenic
1098501051 12:71192214-71192236 AACAAACATACCACTTCTGTCGG - Intronic
1098908367 12:76184543-76184565 AACAATCTTTTAATTTTTCTTGG + Intergenic
1099667219 12:85647378-85647400 AACTAAAATTTCACTTGTCTGGG - Intergenic
1100302149 12:93317597-93317619 AACAAGCATCTCATTTCTGTAGG + Intergenic
1100344376 12:93712875-93712897 AAAAATCAATTCATTTCTCCAGG - Intronic
1100394322 12:94171498-94171520 AACAATCATCCCATTTCTCTGGG - Intronic
1101347421 12:103899526-103899548 CACATTCCCTTCACTTCTCTGGG - Intergenic
1101688951 12:107056660-107056682 AACAATCTTTTGGCTTCCCTGGG - Intronic
1101704040 12:107203856-107203878 GACATATATTTCACTTCTCTTGG + Intergenic
1101760804 12:107657278-107657300 GCCAATCAAATCACTTCTCTGGG - Intronic
1101864001 12:108506508-108506530 ACAAGTCATTTCACATCTCTGGG + Intergenic
1103608041 12:122102566-122102588 AACTATATTTTCATTTCTCTTGG - Intronic
1104360254 12:128126331-128126353 AACTAATATTTCATTTCTCTTGG - Intergenic
1104456370 12:128916353-128916375 ACCTATGTTTTCACTTCTCTTGG + Intronic
1104592292 12:130094286-130094308 ACCAGTCATTTCACCTCTCCTGG - Intergenic
1104929974 12:132333512-132333534 AACCAGCATTTCCCTTCACTGGG - Intergenic
1105220532 13:18322425-18322447 GCAAACCATTTCACTTCTCTTGG + Intergenic
1106369572 13:29118301-29118323 AAGAATCATCTCACCTCTCCTGG - Intronic
1107384740 13:39895795-39895817 AATTATCATTTCACTTGTCTGGG - Intergenic
1107570515 13:41652637-41652659 AGTAGTCATTTCACCTCTCTGGG - Intronic
1107733157 13:43368853-43368875 GCAAATCACTTCACTTCTCTGGG - Intronic
1107802375 13:44120817-44120839 AAAAATCATTTTACTTTTTTTGG + Intergenic
1108221958 13:48244032-48244054 ATAAATAATTTTACTTCTCTGGG + Intronic
1108236423 13:48412016-48412038 AACAATCTTTGCATTTCTTTTGG + Exonic
1108923695 13:55709997-55710019 AAAAATCATTTTACTACTCTTGG - Intergenic
1109298501 13:60564586-60564608 GAAAATCACTTCACCTCTCTTGG + Intronic
1109868492 13:68299508-68299530 ATCATTCACTTCACTTCTTTTGG + Intergenic
1110348529 13:74478113-74478135 GAAACTCCTTTCACTTCTCTTGG - Intergenic
1111376759 13:87389906-87389928 AACAATCTCTTCACTAATCTGGG - Intergenic
1111958613 13:94784708-94784730 AGCAATCTTTTCACTTCCCTGGG - Intergenic
1112391051 13:98984746-98984768 AAAAGTCACTTCACCTCTCTGGG + Intronic
1113360228 13:109623662-109623684 ACAAACCATTTGACTTCTCTTGG - Intergenic
1113874573 13:113585774-113585796 AAAAATCATTTTTCTTCTCTGGG + Exonic
1114232731 14:20798815-20798837 ACCAATTCTTCCACTTCTCTTGG - Intergenic
1114581580 14:23765230-23765252 AACAATCCTTTCAAGTGTCTTGG + Intergenic
1114806491 14:25843148-25843170 AAAAATCATTTTACATCTCTAGG - Intergenic
1115223042 14:31076151-31076173 AACCATGCTTTCAGTTCTCTTGG + Intronic
1115571265 14:34668699-34668721 AATAATCATTTTATTTCTCATGG - Intergenic
1116054224 14:39842951-39842973 CACATTCTTTTCAATTCTCTAGG - Intergenic
1116138831 14:40961724-40961746 ATCTAGCATTTCAATTCTCTTGG - Intergenic
1117222204 14:53617361-53617383 AACAATTAGGTCACTTTTCTAGG - Intergenic
1117918822 14:60706235-60706257 AAATATCAGTTCACCTCTCTGGG - Intergenic
1118106720 14:62668218-62668240 TAAAATCATTTCACTTCAATTGG - Intergenic
1118392828 14:65309993-65310015 AACAATCATTTCCCTGTTTTTGG - Intergenic
1118568156 14:67165352-67165374 ACCAATCACTTAACCTCTCTAGG + Intronic
1119597823 14:75952524-75952546 AACTATGTTTTCATTTCTCTTGG - Intronic
1120062699 14:80002752-80002774 CATAATCTTTTCACTTCTCTGGG - Intergenic
1120248169 14:82030121-82030143 AAAAATCACTTCACCTCTCTGGG - Intergenic
1121747555 14:96310587-96310609 AGCAATCATCTAAATTCTCTGGG + Intronic
1121846575 14:97177457-97177479 AACAATCTACTGACTTCTCTTGG + Intergenic
1121992257 14:98569978-98570000 ACAAATGTTTTCACTTCTCTTGG + Intergenic
1122166126 14:99825395-99825417 TACAATGATTTCACTTCCTTTGG + Intronic
1202905706 14_GL000194v1_random:71102-71124 AATAATATTTTCACTTTTCTTGG - Intergenic
1123711934 15:22994689-22994711 AATATACATTTCATTTCTCTTGG + Intronic
1124923185 15:34046518-34046540 AACGATCATTCCCCTTTTCTAGG + Exonic
1125808056 15:42511642-42511664 AACATTCATTTAGCCTCTCTCGG + Intronic
1126307959 15:47282822-47282844 AACCATCTTTTCCCTTTTCTAGG + Intronic
1126557962 15:50011077-50011099 ACCAATCACTTAACCTCTCTGGG - Intronic
1127358871 15:58227251-58227273 GAAAGTCATTTCACTTCCCTAGG - Intronic
1127736713 15:61847434-61847456 AAAAATCCCTTTACTTCTCTTGG - Intergenic
1128352675 15:66901532-66901554 GGCAATGATGTCACTTCTCTGGG - Intergenic
1128433370 15:67621717-67621739 AATAATCATTTGATTGCTCTAGG - Intronic
1128663089 15:69517179-69517201 TTCCATCATTTCCCTTCTCTGGG - Intergenic
1128734614 15:70046129-70046151 AGACATCATTTCACTTCTCTGGG + Intergenic
1128951183 15:71883915-71883937 AAAAATTATTTAACTTCTCTGGG + Intronic
1129139361 15:73583185-73583207 ACCAGTCACTTCCCTTCTCTGGG - Intronic
1129144966 15:73638549-73638571 GACATATATTTCACTTCTCTTGG - Intergenic
1129948211 15:79560509-79560531 AAAAATCATTTTTCTTCTCTGGG - Intergenic
1131872427 15:96776231-96776253 ATCCATCACTTCCCTTCTCTTGG + Intergenic
1132493170 16:245575-245597 AACAATCTTTTGGCTTCCCTGGG + Intronic
1133659837 16:7905517-7905539 CACAAGCCATTCACTTCTCTGGG - Intergenic
1134322164 16:13174020-13174042 AAAAGTCATATCACCTCTCTAGG + Intronic
1134666237 16:16020949-16020971 CACAATCATGTCACTTCGCTTGG + Intronic
1135717005 16:24780011-24780033 AACAGTTATTTCACCTCTTTGGG - Intronic
1137312563 16:47280041-47280063 AACAATCATGTCACCTCAATAGG + Intronic
1137371313 16:47908641-47908663 AATAATTATTTCACTTCCATTGG - Intergenic
1138925776 16:61589752-61589774 GCCACTCATATCACTTCTCTGGG - Intergenic
1139048599 16:63095337-63095359 AAGAAACCCTTCACTTCTCTGGG + Intergenic
1139148802 16:64354922-64354944 AACAATGATTTAACTTTTCTGGG + Intergenic
1140346340 16:74216671-74216693 AGAAGTCACTTCACTTCTCTGGG + Intergenic
1140606440 16:76544799-76544821 AATAATCATTTCTCTTTTTTGGG + Intronic
1140676052 16:77330978-77331000 AACAATTAATTCAGTTGTCTTGG + Intronic
1141074787 16:80994820-80994842 AAACATCATTTTATTTCTCTTGG - Intronic
1141707701 16:85677235-85677257 GACGATCATTTCACCTCTCAAGG + Exonic
1141901087 16:86991046-86991068 AATAAACATTTCACTTCATTTGG - Intergenic
1142937237 17:3345029-3345051 AACAATCATTTTATTCTTCTTGG - Intergenic
1146446175 17:32934584-32934606 AGCCACCATTTCACTCCTCTTGG + Intronic
1146475040 17:33156014-33156036 AGAAATCATTTAACCTCTCTGGG + Intronic
1146987571 17:37235353-37235375 GAAAATCATTTTACCTCTCTGGG + Intronic
1147935721 17:44009633-44009655 AGCCATCTTTTAACTTCTCTGGG - Intergenic
1149097012 17:52855373-52855395 AACAATCAGTACACTTCACATGG - Intergenic
1149149903 17:53549459-53549481 GTCACTCATTTCACTTCTTTAGG + Intergenic
1149782108 17:59406161-59406183 CACGATTACTTCACTTCTCTGGG - Intergenic
1149819110 17:59757953-59757975 AGCAATCCTTCCACTTCACTGGG + Intronic
1149880286 17:60283131-60283153 AACAATCATCTCAATTGTCAAGG + Intronic
1150110154 17:62492008-62492030 AGGAGTCATTTCAATTCTCTGGG + Intronic
1151235062 17:72713921-72713943 AAATGTCATTTCACTTCTCTGGG - Intronic
1151306576 17:73266544-73266566 AACAATCACTCAACTTCTCTGGG - Intergenic
1151677958 17:75609468-75609490 AAAAATCATTTCCCTTAGCTTGG - Intergenic
1151775640 17:76199635-76199657 AACACTGATTCAACTTCTCTGGG + Intronic
1151900641 17:77011010-77011032 AACTATCATTTAAATTCTCCTGG - Intergenic
1153193934 18:2572215-2572237 GACAATCCTTTTACTTCTCTGGG - Intronic
1156128497 18:33938164-33938186 ACAAATCATTCCACCTCTCTGGG + Intronic
1156410568 18:36824346-36824368 AAATATCTTTTCATTTCTCTTGG + Intronic
1156492345 18:37503674-37503696 ATAAATCTCTTCACTTCTCTGGG + Intronic
1156606195 18:38670262-38670284 AAAAATCCTTACACTTCTCTAGG + Intergenic
1156611272 18:38727673-38727695 AACAAGCCTTTAACTTCTGTGGG - Intergenic
1156946214 18:42835941-42835963 CCAAATCATTTCACTTCTTTGGG + Intronic
1157223410 18:45842617-45842639 GACACTCTCTTCACTTCTCTGGG + Intronic
1158063193 18:53372691-53372713 AAAAATTTTTTAACTTCTCTAGG - Intronic
1158177314 18:54671026-54671048 TAAAAACATTTCACTTCTTTAGG - Intergenic
1160284197 18:77524745-77524767 CATACGCATTTCACTTCTCTTGG - Intergenic
1162868755 19:13569570-13569592 AAGAGTCACTTCACCTCTCTGGG - Intronic
1163684612 19:18704088-18704110 AACGAGCACTTCACTTCTGTGGG - Intronic
1164288829 19:23849056-23849078 AACCAACATTTCACTTTTCCTGG + Intergenic
1164487805 19:28675830-28675852 AACATATATTTCATTTCTCTTGG - Intergenic
1164793739 19:31009436-31009458 AACCATCATGTCAGTTATCTAGG - Intergenic
1167385189 19:49158731-49158753 GCAAATCATTTCACCTCTCTGGG + Intronic
1168150646 19:54446133-54446155 AAAACTCGTTTCCCTTCTCTCGG - Intergenic
925754131 2:7117608-7117630 AATAATAATTTTACTTCTGTAGG - Intergenic
926957472 2:18317335-18317357 AAAAATTATTTCAATGCTCTTGG - Intronic
927348490 2:22076662-22076684 AACTATGTTTTCATTTCTCTTGG + Intergenic
927726868 2:25432034-25432056 AACAATAATCTCCATTCTCTGGG + Intronic
928161429 2:28929557-28929579 AACAATCCTTTCTGTTCTGTAGG + Exonic
929221188 2:39466566-39466588 TACATTCATATCAGTTCTCTAGG - Intergenic
929528108 2:42725276-42725298 AAAATTTAATTCACTTCTCTAGG - Intronic
929794554 2:45049139-45049161 AAAAATCACTTCCCTTCTCTTGG + Intergenic
930260305 2:49139054-49139076 ACAAATCATTTCATTTCACTGGG + Intronic
930381994 2:50641698-50641720 AAGAATAATTTAACTTCTCTTGG + Intronic
930497248 2:52161610-52161632 AACAAATATTTCATTTCTCTTGG + Intergenic
930658980 2:54035106-54035128 CAAAATCACTTAACTTCTCTAGG + Intronic
930756862 2:54983830-54983852 AAAAGGCATTTAACTTCTCTGGG + Intronic
931202119 2:60107556-60107578 GAAAATGATTTCACTTCTCTGGG - Intergenic
931823877 2:65979350-65979372 AATAATTAATTCACTTCTCTGGG - Intergenic
932632450 2:73357068-73357090 CACAAACATTTCATTTCTCTTGG - Intergenic
933280329 2:80325880-80325902 ACCAATCACTTTACTACTCTGGG - Intronic
933519656 2:83354028-83354050 AATAATCATTTATCTTATCTAGG + Intergenic
933558608 2:83863685-83863707 AAATATCATTTCACTTCTCTAGG - Intergenic
933559193 2:83871013-83871035 AAAAATAATTCCATTTCTCTTGG + Intergenic
933778529 2:85786375-85786397 ACAAGTCATTTGACTTCTCTAGG - Intronic
934169904 2:89531823-89531845 GAAAATTATTTAACTTCTCTGGG + Intergenic
934183525 2:89650050-89650072 TCAAACCATTTCACTTCTCTTGG - Intergenic
934280206 2:91606131-91606153 GAAAATTATTTAACTTCTCTGGG + Intergenic
935276430 2:101479665-101479687 AACAATCTTTACACATCTATTGG - Intergenic
935283831 2:101545775-101545797 AACATTCCCTTCACCTCTCTGGG + Intergenic
935546741 2:104407543-104407565 AAGAATATTTTCACTTCTTTCGG - Intergenic
935796569 2:106647348-106647370 ATCAATCATTTTGCTTCCCTGGG - Intergenic
936454916 2:112665672-112665694 TTCAATCTTTTCACTTCCCTGGG - Intergenic
937348994 2:121147973-121147995 AACATTTTTTTCACTTCCCTGGG - Intergenic
938803423 2:134784556-134784578 GACAACCACTTCACCTCTCTGGG - Intergenic
940098669 2:150008090-150008112 AGCTATCATGTCTCTTCTCTGGG + Intergenic
940129225 2:150362523-150362545 TTCAACCATTTCACTTGTCTTGG + Intergenic
940520975 2:154747709-154747731 AACTCTAATTTCATTTCTCTTGG - Intronic
940887319 2:159000983-159001005 AGCAATTACTTCACCTCTCTGGG - Intronic
941394523 2:164957486-164957508 AACAAGAATTTCACCTCTGTTGG - Intergenic
941542049 2:166798579-166798601 AACAATTTTTTGAATTCTCTTGG + Intergenic
944154678 2:196596779-196596801 CACAATCACTCCACTTCTTTCGG - Intergenic
944763825 2:202844111-202844133 AAAAATGTTTTCATTTCTCTTGG + Intronic
945488453 2:210426317-210426339 AACCAGCATTACACTTTTCTTGG + Intergenic
945623887 2:212175877-212175899 ACCATTCACTTTACTTCTCTGGG - Intronic
945728561 2:213504102-213504124 AACAATCATTCCACCACTATTGG - Intronic
947274310 2:228373088-228373110 ACCAATCATTCCAGTTCTGTAGG - Intergenic
947608851 2:231509443-231509465 AACAACTATTTCAACTCTCTAGG + Intergenic
948011264 2:234651075-234651097 AACATAGATTTCATTTCTCTTGG + Intergenic
948233030 2:236365717-236365739 ACCAACCTTTTCACCTCTCTGGG - Intronic
948345889 2:237297775-237297797 AAGAATCATCTTGCTTCTCTAGG + Intergenic
948356720 2:237384149-237384171 CAGAATCATTTCATTTCTCTGGG + Intronic
1168812995 20:718500-718522 AGAAATCATGTCACCTCTCTGGG + Intergenic
1169076625 20:2763918-2763940 AAGTCTCTTTTCACTTCTCTAGG + Intergenic
1169897994 20:10524416-10524438 AACAATCATTTCATGTTTCTCGG - Intronic
1170264855 20:14454681-14454703 ACAAATCACTTAACTTCTCTGGG - Intronic
1170381909 20:15770402-15770424 AAGACTGACTTCACTTCTCTGGG + Intronic
1170787496 20:19480263-19480285 AGAAGTCATTTCACCTCTCTGGG + Intronic
1172023636 20:31933586-31933608 AAAAGCCATTTCACTTCCCTGGG - Intronic
1172386021 20:34534766-34534788 AACCATAATTTCATTTTTCTTGG - Exonic
1172850257 20:37956864-37956886 AAAAAATATTTCACTTCTTTTGG - Intergenic
1173278043 20:41601832-41601854 TCCAATTATTTCACTGCTCTGGG + Intronic
1175395265 20:58653219-58653241 AACATTCATTTCACCTCTTAGGG + Intronic
1177546079 21:22561101-22561123 AACAATCATTTCGTTGCACTAGG - Intergenic
1177744403 21:25193852-25193874 AAAAGACATTTCACTTCTTTGGG + Intergenic
1177879280 21:26672895-26672917 AAAAGTCATTACATTTCTCTTGG + Intergenic
1178463494 21:32825004-32825026 AACATGTATTTCACTTCTCTTGG - Intergenic
1179305129 21:40146559-40146581 AAAAATGATTTTACTGCTCTTGG - Intronic
1180191320 21:46164869-46164891 TAGAATCATTTCTCTTCTATAGG - Intronic
1180235347 21:46456009-46456031 AAGAATCATTTCTTATCTCTAGG - Intergenic
1180513568 22:16118156-16118178 AACAATCATTTCTATTTTGTAGG + Intergenic
1181674539 22:24443035-24443057 AGCAATCATGTAACCTCTCTGGG - Intergenic
1181826720 22:25522674-25522696 AACTATGACTTCACCTCTCTTGG + Intergenic
1182080603 22:27526109-27526131 AAAAGTGTTTTCACTTCTCTTGG - Intergenic
1182365848 22:29778470-29778492 AACGATCATTTCCCATATCTTGG - Intergenic
1183756705 22:39773685-39773707 ATCATTCATTGCAATTCTCTGGG + Intronic
1184301606 22:43564020-43564042 GGCAATCACTTCACCTCTCTGGG + Intronic
1184985214 22:48127750-48127772 AACAATCCTGTCTTTTCTCTTGG - Intergenic
949698610 3:6729146-6729168 AACCACCATTTGACTTCTTTTGG - Intergenic
949719794 3:6975440-6975462 GAAAATCATTTCACTTCTCTAGG + Intronic
949845541 3:8366697-8366719 AACACTCATTTCAATTCAATAGG + Intergenic
949961816 3:9318463-9318485 AGCAAACATTCCACTGCTCTGGG - Intronic
950836480 3:15924538-15924560 ATAAATCATGTTACTTCTCTGGG + Intergenic
951801118 3:26596936-26596958 AACTAGAATTTCAGTTCTCTGGG - Intergenic
952356363 3:32588248-32588270 ATAAATCATTTCACTTCTCTAGG + Intergenic
952928554 3:38341264-38341286 TCCAATCTTTTCACTTCCCTGGG + Intergenic
953034493 3:39200390-39200412 AACATTTAGTTCACTTTTCTTGG + Intergenic
955583961 3:60456268-60456290 AACCATCATTTCAGATATCTGGG - Intronic
955618692 3:60837280-60837302 AACATTTTTTTCTCTTCTCTTGG - Intronic
955619109 3:60842581-60842603 TACACTCATTTAATTTCTCTAGG - Intronic
956024230 3:64965268-64965290 ATCAATATTTTCACTTTTCTTGG + Intergenic
956607899 3:71091560-71091582 AACCATCATTTACCATCTCTGGG - Intronic
957117081 3:76040458-76040480 AACCATCATTCCAATTCACTAGG + Intronic
957816999 3:85313502-85313524 AACCTTCAGTTCACTTCTTTTGG + Intronic
959425058 3:106177123-106177145 AAGAGTCATTTCACTTCTCTAGG + Intergenic
959952956 3:112201686-112201708 CACAATCATTTAACCTCTCTTGG + Intronic
960242187 3:115357856-115357878 AACATTCATTCCACATCCCTTGG - Intergenic
960460400 3:117927595-117927617 AATAATATTCTCACTTCTCTTGG + Intergenic
960666008 3:120109467-120109489 AATATTCACCTCACTTCTCTGGG - Intergenic
961123671 3:124396526-124396548 GACAGTCATTTAACCTCTCTGGG + Intronic
962193307 3:133333941-133333963 AAAAGTCATTTCCTTTCTCTGGG + Intronic
962482694 3:135811315-135811337 AAAACTCATCTCACTCCTCTCGG - Intergenic
962494927 3:135929623-135929645 ACCAATCATTTCTCCTCTCCTGG + Intergenic
962551962 3:136502676-136502698 CCCAATCATTTTATTTCTCTCGG + Exonic
963076392 3:141351179-141351201 AACAGTAATGTCAGTTCTCTAGG - Intronic
964505311 3:157392525-157392547 TACAATCATTTGGCTTCCCTGGG + Intronic
964521805 3:157577579-157577601 AAAAATAATTTAACTTCTCTAGG + Intronic
965931461 3:174048389-174048411 ACCAATGATTTCACCTCTCACGG - Intronic
966229850 3:177640284-177640306 AGCAATTGTTTCACTTTTCTGGG + Intergenic
966234741 3:177687972-177687994 AACAATGTTTTCAATTTTCTGGG + Intergenic
966771111 3:183504118-183504140 ATCAATCATTTTCCTTCTCTGGG - Intronic
966786476 3:183627488-183627510 TAAAATCATTTCATTTCTCCAGG + Intergenic
967095629 3:186175102-186175124 AAAAATCATTTCCCTCCTCAGGG + Intronic
967276644 3:187782466-187782488 GGCAATCACTTCAGTTCTCTGGG - Intergenic
967293687 3:187945655-187945677 AACATTCATTTCCCCTCTTTGGG - Intergenic
967354017 3:188547655-188547677 AGCAGTCATTTCACATTTCTGGG - Intronic
967356278 3:188575481-188575503 AAAAAATATTTAACTTCTCTAGG - Intronic
967366426 3:188691652-188691674 GGAAATCATTTCACCTCTCTGGG - Intronic
967381022 3:188858198-188858220 ATCTATCATTTGACTTGTCTCGG + Intronic
967449235 3:189604196-189604218 AGAAATTGTTTCACTTCTCTTGG + Intergenic
967859434 3:194140617-194140639 ATAAGTCATTTCCCTTCTCTGGG + Intergenic
967915529 3:194575531-194575553 AACCATCATTTCTAATCTCTTGG + Intergenic
968345792 3:198006244-198006266 ATCAATAATTTCACTTTTCATGG + Intronic
970046022 4:11855270-11855292 TCCAATCTTTTCACTTCCCTGGG - Intergenic
970162202 4:13200287-13200309 AACAGACTTTTCCCTTCTCTAGG - Intergenic
970215133 4:13750912-13750934 AACCATGATTTCACTTTCCTGGG + Intergenic
970292615 4:14591425-14591447 AACATACATTTCAGTTTTCTTGG - Intergenic
970448455 4:16143286-16143308 ACCTATAATTTCATTTCTCTTGG - Intergenic
970609745 4:17714070-17714092 AAGAACCATATCACTTCTTTGGG + Intronic
971014822 4:22477319-22477341 GACAGTCACTTCACTTTTCTAGG + Intronic
971020246 4:22527942-22527964 CACATTCATTTTACCTCTCTTGG - Intergenic
971575208 4:28264094-28264116 GAAAATCATTTAACCTCTCTGGG - Intergenic
971598332 4:28560322-28560344 AATAATCAGTTATCTTCTCTCGG + Intergenic
974670579 4:65025015-65025037 ATTAATCATTTCTCTTCCCTGGG - Intergenic
974808291 4:66911317-66911339 AACATTCATTTCACAGCTTTTGG + Intergenic
975457389 4:74608318-74608340 AACAATCATTGCATTCCACTGGG - Intergenic
976710535 4:88066303-88066325 CAGAATAATTTCACATCTCTTGG - Intronic
978084838 4:104638310-104638332 AAATATAATTTCACTTCTCATGG + Intergenic
978227207 4:106351338-106351360 AACAATTATTTCATTGTTCTGGG - Intergenic
978768341 4:112428289-112428311 AACATCCTTGTCACTTCTCTGGG - Intronic
978925694 4:114240270-114240292 AAAAATGATTTCACTTCTTGTGG + Intergenic
979504163 4:121476343-121476365 AAATGTTATTTCACTTCTCTAGG - Intergenic
979550479 4:121985552-121985574 AATTATTATTTCACTTTTCTTGG - Intergenic
980892985 4:138834581-138834603 AACATTCATTGTACTTTTCTAGG + Intergenic
980978880 4:139636788-139636810 AACCAACATTACACTTCTCCTGG - Intergenic
981055026 4:140351576-140351598 AACAATTGTGCCACTTCTCTGGG - Intronic
981690745 4:147506016-147506038 AACAAAATTTTCACTTCTCTGGG - Intronic
982161547 4:152575274-152575296 AACAATTATTTCAATTATCCCGG + Intergenic
982201461 4:152965405-152965427 TAAAATCATTTCACAGCTCTTGG - Intronic
982355033 4:154457064-154457086 AACAAACATTTAAGTGCTCTAGG - Intronic
983168431 4:164508010-164508032 GAGCATCATTTCACTTCTCTGGG + Intergenic
983454641 4:167947651-167947673 TACAAGCATTTCACTTGTTTCGG - Intergenic
984277691 4:177629097-177629119 ACAAATGTTTTCACTTCTCTTGG + Intergenic
985125426 4:186689125-186689147 AATAAAGATTTCACTTCACTTGG + Intronic
985262869 4:188131046-188131068 AAAAATTATTTCTCTTCTTTGGG - Intergenic
985288995 4:188367480-188367502 TACACTCATTTCATTTCACTGGG + Intergenic
985469958 5:34621-34643 CACTACCATTTCACTTCTCTTGG + Intergenic
986444932 5:7812972-7812994 TAGAGTCATTTAACTTCTCTGGG - Intronic
986876244 5:12114201-12114223 AAGGAAGATTTCACTTCTCTAGG - Intergenic
987850527 5:23347364-23347386 AATATTCATTTAACTTCTTTTGG + Intergenic
988096594 5:26620255-26620277 AAAAATATTTTCAATTCTCTAGG + Intergenic
989416324 5:41181501-41181523 TACAAGGATTTAACTTCTCTTGG - Exonic
989444647 5:41512922-41512944 GACAATCATGTAATTTCTCTGGG + Intergenic
990136531 5:52651440-52651462 AAGTATCTTTTCACTTTTCTGGG + Intergenic
990504909 5:56434413-56434435 GAAAGTCACTTCACTTCTCTGGG + Intergenic
990711660 5:58588189-58588211 TAATATCTTTTCACTTCTCTTGG + Intronic
990762106 5:59141372-59141394 AAAAACTATTTCACTTCTCTTGG - Intronic
990842672 5:60101227-60101249 TGCATTCATTTCATTTCTCTAGG - Intronic
990917669 5:60928606-60928628 AACAAACATTGAACTTCTTTTGG - Intronic
990947433 5:61263634-61263656 AACAAACATCTTACTTCTCATGG - Intergenic
990990503 5:61678959-61678981 ACCAGTCACTTCACCTCTCTAGG + Intronic
991772512 5:70052927-70052949 GACAATCATTCCACTTCATTAGG - Intronic
991851805 5:70928351-70928373 GACAATCATTCCACTTCATTAGG - Intronic
991961733 5:72051399-72051421 CAAAACCATATCACTTCTCTTGG + Intergenic
991963819 5:72071726-72071748 GGCAATCATTTCACTTCCCTTGG - Intergenic
992201529 5:74389226-74389248 AACCATCATCTCACTTTGCTTGG - Intergenic
992555582 5:77899777-77899799 AGCTAGCATTTCACTTGTCTTGG - Intergenic
993913272 5:93709871-93709893 GTCAATCATTTAACTTCTATGGG - Intronic
993942423 5:94075926-94075948 ACAAATTATTTAACTTCTCTGGG + Intronic
994447019 5:99889052-99889074 AACAATAACTTCAGTTTTCTGGG + Intergenic
994566510 5:101453292-101453314 AATAATGATTTCATTTCCCTTGG - Intergenic
994626718 5:102229416-102229438 AACAATCACTTCAGGTCCCTGGG - Intergenic
994771897 5:103992204-103992226 AATAAAAATTTCACTTTTCTGGG + Intergenic
995076368 5:107989622-107989644 AACACTGATTTCCTTTCTCTTGG + Intronic
995914985 5:117234384-117234406 TACAATCTTTTGACTTCCCTGGG + Intergenic
995977023 5:118050799-118050821 AACAATGTTTTTATTTCTCTTGG - Intergenic
996121603 5:119679993-119680015 ATCAATAATTTCAATTCTGTGGG - Intergenic
997192842 5:131955103-131955125 AACAATCTTCCCATTTCTCTTGG - Intronic
997237520 5:132282090-132282112 AGCAATCATTCCAGTTCTGTTGG + Intronic
997845359 5:137281232-137281254 AAAAATGATTTTACTTTTCTGGG - Intronic
997929509 5:138060697-138060719 GACAATTATTTCACTGGTCTCGG - Intergenic
998503260 5:142652096-142652118 AGCAATTATTTAACTTCTCTGGG - Intronic
998652973 5:144141944-144141966 AACATCCATTTCCCTTCTCCTGG - Intergenic
998928612 5:147155802-147155824 AACAAGGGTTTGACTTCTCTGGG + Intergenic
999856189 5:155596903-155596925 AGCATCCATTTCAGTTCTCTAGG - Intergenic
1000093388 5:157949544-157949566 ACAAATTATTTCACTTCCCTGGG + Intergenic
1000453660 5:161421351-161421373 AAAAGTCATTTCAGTTATCTGGG - Intronic
1000462062 5:161535602-161535624 ACAAATCATTTAACCTCTCTGGG + Intronic
1000468850 5:161613213-161613235 GAAAATCACTTCACCTCTCTGGG + Intronic
1001231043 5:169988804-169988826 GAGAGTCATTTCACCTCTCTGGG - Intronic
1001763764 5:174228476-174228498 AACATTCATTCCACTGCCCTGGG - Intronic
1001874096 5:175184403-175184425 AATAATCAGTACACTTCTTTAGG - Intergenic
1002093048 5:176816061-176816083 ACAAATCATTTAACCTCTCTGGG + Intronic
1002560639 5:180079677-180079699 AGCCATCCTGTCACTTCTCTTGG - Intergenic
1003189231 6:3858728-3858750 CACAAATATTTCATTTCTCTTGG + Intergenic
1003420170 6:5950509-5950531 CACATCAATTTCACTTCTCTTGG + Intergenic
1003430677 6:6034552-6034574 AAAAATCTTTCCACTTCTATGGG - Intergenic
1003783325 6:9454587-9454609 AGCCATCATTTAACTTCTTTTGG - Intergenic
1004164746 6:13246884-13246906 TATGATCATTTCACTCCTCTTGG + Intronic
1004966479 6:20857624-20857646 AACAATCATTTCAAATGTTTGGG + Intronic
1005488369 6:26322730-26322752 AACAATGATTTCACTATACTTGG + Intergenic
1005915907 6:30351340-30351362 AACATTCATTTCCCTTCCATAGG - Intergenic
1006584595 6:35099868-35099890 AACATTCTTTTACCTTCTCTGGG - Intergenic
1008296024 6:49778581-49778603 GCAAATCATTTCACTTCTCTGGG - Intergenic
1008599321 6:53074937-53074959 AACATAATTTTCACTTCTCTGGG + Intronic
1009589763 6:65652439-65652461 CACCACCATTACACTTCTCTGGG - Intronic
1009733134 6:67635708-67635730 ATCATACATTTCATTTCTCTGGG - Intergenic
1010760618 6:79718409-79718431 AGCAATCATTTTACTTCTCTAGG + Intergenic
1010885964 6:81240848-81240870 ACCAATCATTTCATATTTCTTGG + Intergenic
1010922576 6:81702809-81702831 GACAATCATTTAATTTCTCTGGG - Intronic
1011642332 6:89427333-89427355 AACATAGTTTTCACTTCTCTGGG - Intergenic
1011960804 6:93087342-93087364 AAAAATTATTACACTTCTGTTGG + Intergenic
1012153252 6:95782399-95782421 AATGATCATTTTACTTCTATGGG + Intergenic
1012570544 6:100721516-100721538 AACTATCATCTCTATTCTCTAGG - Intronic
1014279654 6:119427317-119427339 AACAATCATTTCACAAATATAGG - Intergenic
1014731910 6:125042264-125042286 AACAATGATTCCAATTCTGTAGG + Intronic
1014789546 6:125656824-125656846 AACAAACATTTCTATTTTCTAGG + Intergenic
1015435282 6:133179275-133179297 AACAAACATTTATCTTCTGTGGG - Intergenic
1015735995 6:136400682-136400704 AAGCATCATTTCACTTCTTTGGG - Intronic
1016164356 6:140922068-140922090 AACAATCATTTGAAATCTGTTGG + Intergenic
1016548715 6:145253262-145253284 TATAATCATTTCACTTCTCTTGG + Intergenic
1017078238 6:150639990-150640012 AGGAGTCATTTCACTTCTTTAGG - Intronic
1017236150 6:152119389-152119411 AAAAATCCTTTCATTTCTCCCGG + Intronic
1022271835 7:28815631-28815653 AACACTCAATTCTATTCTCTGGG - Intronic
1022483255 7:30758050-30758072 ACTAATTGTTTCACTTCTCTGGG + Intronic
1022527082 7:31045123-31045145 AACAGTTCTTTCCCTTCTCTGGG + Intergenic
1022732472 7:33042655-33042677 AACTATCATTTCAATATTCTTGG - Intronic
1022905600 7:34852398-34852420 ACAAATCATTTCACACCTCTGGG + Intronic
1023202867 7:37717827-37717849 AACAATCTTTATACATCTCTTGG + Intronic
1023325582 7:39052263-39052285 TACTATCATTTCATTTCTCTGGG - Intronic
1024703615 7:51932545-51932567 CACACTCATTTCACTTCCTTTGG + Intergenic
1024950838 7:54858639-54858661 AAGTATCATTCCACTTCTCTTGG - Intergenic
1026368786 7:69677187-69677209 ATCAAGCACCTCACTTCTCTGGG - Intronic
1026670856 7:72389553-72389575 AACAGTCATTTGACTTCTTAAGG - Intronic
1027860082 7:83566532-83566554 AACAAGTATTTCACTACTCTTGG - Intronic
1028201236 7:87964392-87964414 AAAAGGCATTTCACTTTTCTAGG + Intronic
1028381630 7:90206439-90206461 AAAAATGTTTTCAGTTCTCTTGG + Intronic
1028824138 7:95249830-95249852 ACAAATCATTTCACTTTTCAAGG + Intronic
1030547124 7:110909829-110909851 AAGAATCCCTTCCCTTCTCTTGG - Intronic
1031241096 7:119241287-119241309 AAATATCATATCACTTCTATGGG - Intergenic
1031348623 7:120700690-120700712 ATCAATTCTTTCAGTTCTCTAGG + Intronic
1031361559 7:120855057-120855079 AACAAAAATATCACTCCTCTTGG - Intronic
1031385784 7:121149189-121149211 AAATAACATTTCACTTCCCTAGG - Intronic
1031670601 7:124539665-124539687 AAGAATCATTTCAGTTCTTTAGG + Intergenic
1031964186 7:128015644-128015666 ACCAATCATTTCATTTCTGTTGG - Intronic
1032039172 7:128544317-128544339 AGGAGTCATTTCAATTCTCTGGG + Intergenic
1032606985 7:133366356-133366378 AAGTAACATTTTACTTCTCTAGG + Intronic
1033562007 7:142541397-142541419 AACAATACTCTGACTTCTCTGGG - Intergenic
1033714518 7:143985837-143985859 ATTAATCATTTCCCTTCTTTTGG - Intergenic
1034822261 7:154227083-154227105 CATCATAATTTCACTTCTCTTGG - Intronic
1036425716 8:8643673-8643695 ATAAATCATTTCATTTATCTGGG + Intergenic
1036475918 8:9093156-9093178 ACCAATCTTTTGACTTCCCTGGG + Intronic
1036793091 8:11736379-11736401 AACAGTCATTTCACCTCTCTTGG - Intronic
1036939549 8:13038424-13038446 AAAAATCACTGCCCTTCTCTAGG + Intergenic
1037097395 8:15001853-15001875 AACAAGCTTTTCACTTCTCTGGG - Intronic
1037212273 8:16405172-16405194 AACAATCATCTGGCTTGTCTAGG + Intronic
1037568915 8:20141969-20141991 ACAAGTCATTTCACGTCTCTGGG - Intergenic
1038653285 8:29425314-29425336 AAAAATCAGTTGACTTCTTTGGG + Intergenic
1039084546 8:33766993-33767015 AAAAATGTTTTCCCTTCTCTTGG - Intergenic
1039135017 8:34312163-34312185 AACAAGCATTTCATTTCACAAGG + Intergenic
1039267985 8:35848475-35848497 AATAATCCTTTCATTTCACTTGG - Intergenic
1039274248 8:35918020-35918042 GTCAATTATTTCAATTCTCTGGG - Intergenic
1039325687 8:36483112-36483134 AAAAATCATTTCAGTTATCTGGG + Intergenic
1039582315 8:38676948-38676970 AACAATAACTTCAACTCTCTGGG - Intergenic
1039648565 8:39314876-39314898 GAAAATCGTTTAACTTCTCTGGG + Intergenic
1039769205 8:40665813-40665835 GACAGTCACTTCACGTCTCTGGG + Intronic
1040139892 8:43897506-43897528 AACCAACATTACACTTTTCTTGG - Intergenic
1041316748 8:56571428-56571450 ACCAGTAATTTCACTTCTTTTGG + Intergenic
1042207117 8:66340422-66340444 AACATTCCTTTCACTTCCCTTGG - Intergenic
1043063655 8:75538541-75538563 AACAAACATTTCTTTTCTATAGG - Intronic
1043378874 8:79681622-79681644 TTCAATCTTTTGACTTCTCTGGG + Intergenic
1043453320 8:80390631-80390653 AACAAATACTTCACTTCTCTGGG - Intergenic
1045549853 8:103161921-103161943 TACAATCTGTTCACATCTCTGGG + Intronic
1046542753 8:115607596-115607618 AACAATAATGACACTTCTATAGG + Intronic
1047014279 8:120706540-120706562 AATAATAATTTCTCTTCCCTGGG + Intronic
1047069695 8:121329810-121329832 AAAAATTATTTAACTTCTGTCGG - Intergenic
1047128045 8:121985274-121985296 AACTAAAATATCACTTCTCTGGG + Intergenic
1047420982 8:124708001-124708023 GGAAATCATTTCACTTCTCAGGG + Intronic
1047492025 8:125383001-125383023 AAGAATCATTTCAATGCTGTAGG - Intergenic
1047681808 8:127261381-127261403 AACAAACATTTCAAATCTTTTGG + Intergenic
1047688918 8:127330735-127330757 GATCATCATTTCACTTCACTGGG + Intergenic
1047769057 8:128015975-128015997 TACAATCATTTCACTTGCCAGGG + Intergenic
1047997896 8:130354242-130354264 AGAAATCATTTCATCTCTCTGGG + Intronic
1048205689 8:132413577-132413599 CACAATCATTTCATTCCTCTCGG - Intronic
1050435804 9:5609052-5609074 ACAAGTCACTTCACTTCTCTGGG - Intergenic
1050556818 9:6796397-6796419 AACCATCTCTTCTCTTCTCTGGG + Intronic
1050580506 9:7050188-7050210 ATCAAGAATTTCACTTCACTAGG + Intronic
1051813093 9:21072846-21072868 AAGAATCCTTTCTTTTCTCTTGG + Intergenic
1052404941 9:28047328-28047350 AGCAATCATGTCACTTCATTGGG + Intronic
1052579968 9:30342546-30342568 AAAAATGATTTCAGTTCTTTTGG + Intergenic
1052851507 9:33381171-33381193 AGCAATCCTTTCCATTCTCTTGG - Intergenic
1053099318 9:35357068-35357090 AACTATATTTTCAATTCTCTTGG + Intronic
1053320606 9:37095242-37095264 AAAAATCCTTTCTCTTCTTTGGG - Intergenic
1053463120 9:38285993-38286015 TACAATCTTTTGACTTCCCTGGG + Intergenic
1053543486 9:38998708-38998730 ACTAATCATTTCATGTCTCTGGG - Intergenic
1053617140 9:39780183-39780205 AAATATCCTTTCATTTCTCTTGG + Intergenic
1053807917 9:41822213-41822235 ACTAATCATTTCATGTCTCTGGG - Intergenic
1053875324 9:42539548-42539570 AAATATCCTTTCATTTCTCTTGG + Intergenic
1053897319 9:42755082-42755104 AAATATCCTTTCATTTCTCTTGG - Intergenic
1054236376 9:62562176-62562198 AAATATCCTTTCATTTCTCTTGG - Intergenic
1054267028 9:62927254-62927276 AAATATCCTTTCATTTCTCTTGG - Intergenic
1054384734 9:64537428-64537450 TTCAATCATTTAGCTTCTCTGGG + Intergenic
1054550519 9:66596705-66596727 AAATATCCTTTCATTTCTCTTGG - Intergenic
1054622675 9:67365215-67365237 ACTAATCATTTCATGTCTCTGGG + Intergenic
1054951555 9:70857705-70857727 GAAAATAATTTAACTTCTCTAGG + Intronic
1055293439 9:74809200-74809222 ACCAATCATAACACTTGTCTTGG - Intronic
1056163270 9:83919327-83919349 CACAATGTTTTCATTTCTCTTGG - Intronic
1056494630 9:87143875-87143897 ACCCATCATTTCATTTCTCCTGG + Intergenic
1057776082 9:98010823-98010845 AAAAATCATGTACCTTCTCTTGG - Intronic
1058065421 9:100543608-100543630 TCCAATCATTTGACTTCCCTGGG + Intronic
1058645310 9:107126740-107126762 CACAATCATTCCATTTCTCTGGG + Intergenic
1060239305 9:121889183-121889205 TAAAATTACTTCACTTCTCTGGG - Intronic
1060609684 9:124951566-124951588 AGCAATCAGCTCACTTCTCCTGG + Intronic
1060873819 9:127065477-127065499 AACTATCATTTCACTACTTTGGG - Intronic
1061599635 9:131659230-131659252 AAAAGTCTTTTCACTTGTCTAGG + Intronic
1062316530 9:135970003-135970025 GGCAATCACTTAACTTCTCTGGG + Intergenic
1186085991 X:5991372-5991394 CACAGTCCTCTCACTTCTCTGGG - Intronic
1186636172 X:11407477-11407499 TACACACATTTCATTTCTCTTGG + Intronic
1186767658 X:12788181-12788203 AACAATCATTACATTTCTTTTGG + Intergenic
1187439823 X:19307939-19307961 AATAAGCATTTCACTTCACATGG + Intergenic
1188170586 X:26919040-26919062 AACACTGGTTTCACTTCTTTTGG + Intergenic
1188369831 X:29355524-29355546 AGCAATCATTTCTTTTTTCTTGG + Intronic
1189002705 X:36963467-36963489 AAAAATCATTTTTCTTCTCTGGG - Intergenic
1189064941 X:37797321-37797343 AGAAATTATTTCTCTTCTCTAGG - Intronic
1189141904 X:38615990-38616012 AAAAGTCATTTGACCTCTCTGGG + Intronic
1189648955 X:43168106-43168128 AATGATCAATTAACTTCTCTAGG - Intergenic
1190700336 X:52983571-52983593 AAAAATTATATCAGTTCTCTGGG - Intronic
1192581141 X:72282780-72282802 GACAATGTTTTCATTTCTCTCGG + Intronic
1192706492 X:73532241-73532263 AAGAACCATTTCCCTTCTGTGGG - Intergenic
1192710649 X:73581344-73581366 AAGAAACATTTCATTTCTTTTGG - Intronic
1193138645 X:78001803-78001825 AACAACCATTCCACTTTTCTAGG - Intronic
1194483087 X:94451265-94451287 AACATTCAATGCCCTTCTCTGGG + Intergenic
1194644300 X:96439869-96439891 AAAAGTCAATTCATTTCTCTGGG + Intergenic
1194687693 X:96943901-96943923 ACAAATCATTTAACTTCTCTAGG + Intronic
1194740255 X:97564092-97564114 AACAATTAGTGCTCTTCTCTTGG + Intronic
1195171278 X:102271115-102271137 AAGAAGGATTTCACTTCTCTTGG - Intergenic
1195187582 X:102415984-102416006 AAGAAGGATTTCACTTCTCTTGG + Intronic
1195749689 X:108151308-108151330 AACCATTCTTTCACTACTCTGGG + Intronic
1196397242 X:115277415-115277437 ATAAATGATTTCATTTCTCTTGG + Intergenic
1196440129 X:115711912-115711934 ACCAATCATTTTACTTCTCTAGG - Intergenic
1198052563 X:132962830-132962852 AATAGTCATCTCACTTCTTTGGG + Intergenic
1198508742 X:137327900-137327922 AACACTCTTTCCACTTGTCTTGG + Intergenic
1198682615 X:139198843-139198865 AAATATTATTTCACTTCTTTAGG + Intronic
1199439825 X:147855452-147855474 AAGAATTAATTCACTTCTCTGGG + Intergenic
1199655619 X:149992307-149992329 ACTATTCATTTCCCTTCTCTAGG - Intergenic
1199924445 X:152448124-152448146 AACAAACATTTTCCTTCACTAGG + Intronic
1200426038 Y:3021363-3021385 ACCAATGGTTTCACTTCTTTTGG - Intergenic
1200812405 Y:7499699-7499721 CACACTCATTTCAATTATCTTGG + Intergenic