ID: 1085769032

View in Genome Browser
Species Human (GRCh38)
Location 11:79308817-79308839
Sequence TAGTTTCCTCACCCGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11169
Summary {0: 1, 1: 18, 2: 360, 3: 2532, 4: 8258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085769027_1085769032 10 Left 1085769027 11:79308784-79308806 CCCACAGAACAATCATTTCACTT 0: 2
1: 0
2: 2
3: 23
4: 288
Right 1085769032 11:79308817-79308839 TAGTTTCCTCACCCGTAAAATGG 0: 1
1: 18
2: 360
3: 2532
4: 8258
1085769024_1085769032 29 Left 1085769024 11:79308765-79308787 CCACCTCCTGAGTGCGAGACCCA 0: 1
1: 0
2: 0
3: 3
4: 138
Right 1085769032 11:79308817-79308839 TAGTTTCCTCACCCGTAAAATGG 0: 1
1: 18
2: 360
3: 2532
4: 8258
1085769028_1085769032 9 Left 1085769028 11:79308785-79308807 CCACAGAACAATCATTTCACTTC 0: 1
1: 0
2: 1
3: 20
4: 303
Right 1085769032 11:79308817-79308839 TAGTTTCCTCACCCGTAAAATGG 0: 1
1: 18
2: 360
3: 2532
4: 8258
1085769025_1085769032 26 Left 1085769025 11:79308768-79308790 CCTCCTGAGTGCGAGACCCACAG 0: 1
1: 0
2: 0
3: 23
4: 97
Right 1085769032 11:79308817-79308839 TAGTTTCCTCACCCGTAAAATGG 0: 1
1: 18
2: 360
3: 2532
4: 8258
1085769026_1085769032 23 Left 1085769026 11:79308771-79308793 CCTGAGTGCGAGACCCACAGAAC 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1085769032 11:79308817-79308839 TAGTTTCCTCACCCGTAAAATGG 0: 1
1: 18
2: 360
3: 2532
4: 8258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085769032 Original CRISPR TAGTTTCCTCACCCGTAAAA TGG Intronic
Too many off-targets to display for this crispr