ID: 1085769564

View in Genome Browser
Species Human (GRCh38)
Location 11:79312718-79312740
Sequence CCTTCCAACCAAGAAGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085769564_1085769571 8 Left 1085769564 11:79312718-79312740 CCCAACACTTCTTGGTTGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 180
Right 1085769571 11:79312749-79312771 AGTCGTGGTGAGGTGCAAGATGG 0: 1
1: 0
2: 0
3: 4
4: 100
1085769564_1085769568 -2 Left 1085769564 11:79312718-79312740 CCCAACACTTCTTGGTTGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 180
Right 1085769568 11:79312739-79312761 GGCTGCCACCAGTCGTGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 104
1085769564_1085769573 28 Left 1085769564 11:79312718-79312740 CCCAACACTTCTTGGTTGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 180
Right 1085769573 11:79312769-79312791 TGGAATGGACACCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 28
4: 359
1085769564_1085769572 13 Left 1085769564 11:79312718-79312740 CCCAACACTTCTTGGTTGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 180
Right 1085769572 11:79312754-79312776 TGGTGAGGTGCAAGATGGAATGG 0: 1
1: 0
2: 1
3: 23
4: 262
1085769564_1085769567 -7 Left 1085769564 11:79312718-79312740 CCCAACACTTCTTGGTTGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 180
Right 1085769567 11:79312734-79312756 TGGAAGGCTGCCACCAGTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085769564 Original CRISPR CCTTCCAACCAAGAAGTGTT GGG (reversed) Intronic
905161870 1:36043433-36043455 TCTTCCAACCTAGATTTGTTTGG - Exonic
907197717 1:52700090-52700112 CCTTCCAATAAATAAGTGGTTGG - Intergenic
907505981 1:54918584-54918606 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
907602864 1:55787973-55787995 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
910510024 1:87993044-87993066 CCGTCCAACTATGAAGTGCTGGG - Intergenic
911360611 1:96871832-96871854 CCTTACAACCCAGAAGAGATAGG - Intergenic
911361315 1:96880873-96880895 CCTTCCAACAAAGAATTGTTAGG + Intergenic
911434875 1:97844700-97844722 CCTGCCAACTCAGAAGTGTGTGG - Intronic
911504205 1:98728198-98728220 CCCTGCAAGCCAGAAGTGTTTGG + Intronic
913470694 1:119182612-119182634 GCTTCCAACCCAGAAGCGTTGGG + Intergenic
916701634 1:167301715-167301737 CCTCCCAACCAGGAACTGTAAGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919156237 1:193769595-193769617 CCTTCATAACAAGATGTGTTAGG + Intergenic
919826934 1:201509767-201509789 AATACCAACCCAGAAGTGTTGGG - Intergenic
920425992 1:205875595-205875617 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
921630735 1:217430668-217430690 CTTTCAAACAAAGATGTGTTCGG + Exonic
922685066 1:227632588-227632610 GCTCCCAACCCAGAAGGGTTGGG + Intronic
1066433335 10:35373364-35373386 CCTTGCCACCCAGCAGTGTTGGG + Intronic
1070705285 10:78633016-78633038 CCCTCCAACCAAGCACTGTCTGG - Intergenic
1070806621 10:79274681-79274703 TCTTACAACCAAGAGGTGGTGGG - Intronic
1071327315 10:84530094-84530116 ACTCCCAACCCAGAAGGGTTGGG + Intergenic
1071737734 10:88320105-88320127 CCTTACAAGCAAGAAGAGATTGG + Intronic
1074933765 10:118157538-118157560 CCTGCCAACCAAAAAGTTCTGGG - Intergenic
1076053506 10:127353101-127353123 CCTTCCAGCCAAGCAGGGGTTGG - Intronic
1076168959 10:128304401-128304423 CCTACAAACCAAGGGGTGTTAGG - Intergenic
1077408469 11:2392923-2392945 CCTTGCAACCCAGGAGTGTCAGG + Intronic
1079523830 11:21361313-21361335 CCTTACAAGCAAGAAGGGATTGG - Intronic
1079747256 11:24149144-24149166 CCTTACAAGCCAGAAGAGTTTGG - Intergenic
1080311874 11:30904078-30904100 CCTTCAAACCAAGAACTGACAGG + Intronic
1081070258 11:38602546-38602568 TCTCCCAACCCAGAAGGGTTGGG - Intergenic
1083221931 11:61258496-61258518 CCTTGTTCCCAAGAAGTGTTTGG - Exonic
1085769564 11:79312718-79312740 CCTTCCAACCAAGAAGTGTTGGG - Intronic
1085966034 11:81527732-81527754 CCATCCATCCAAAAAGTCTTGGG + Intergenic
1087045210 11:93838907-93838929 CCTTCCACTCAAGAAGCATTTGG + Intronic
1088091489 11:106045549-106045571 CTTTCCAATCAACAAGAGTTAGG - Intergenic
1090889027 11:130906430-130906452 CCTGCCAACCCAGAACTGGTAGG + Intronic
1091649877 12:2302052-2302074 ACTTACAAGAAAGAAGTGTTTGG + Intronic
1092261924 12:6957537-6957559 CCGTCCATCCAACAAATGTTTGG + Intronic
1092565445 12:9660207-9660229 CCATCCAACAGAGAAGTGGTTGG - Intergenic
1093783547 12:23166200-23166222 CCTTCAAACCAGGAAGTATGCGG - Intergenic
1095138665 12:38637204-38637226 GCTCCCAACCCAGAAGGGTTGGG - Intergenic
1095283557 12:40384600-40384622 GCTCCCAACCCAGAAGGGTTGGG - Intergenic
1095455519 12:42380832-42380854 GCTTCAAACCAAGAAATGCTAGG - Intronic
1096352449 12:50911626-50911648 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
1096867707 12:54575149-54575171 CCACCCAACCAAGCAGTGGTTGG + Exonic
1097067887 12:56334026-56334048 TCTTCCAATCAAGAAGGGCTCGG + Intronic
1100436073 12:94572717-94572739 CCTTTCAGCCAAGGAGTGTGTGG + Intronic
1102228191 12:111244252-111244274 CTTTCCACCCAGGAAGTGTGTGG + Intronic
1102628186 12:114253265-114253287 CCCTCCCACCATGATGTGTTCGG - Intergenic
1104851872 12:131879990-131880012 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
1110738586 13:78967264-78967286 CCTTCCAACTGAAAAGTGTGGGG + Intergenic
1113401810 13:110001234-110001256 GCTCCAAACCAAGAACTGTTAGG - Intergenic
1116229219 14:42194409-42194431 TCTACCAACCCAGAAGTCTTAGG - Intergenic
1117713689 14:58559058-58559080 CCTTCCAATCTAGAAGGGCTTGG - Intergenic
1118616475 14:67577541-67577563 CCTGCCATCCAGGAAGTGATAGG - Intronic
1119577330 14:75737419-75737441 CCTTCCAACCACAAAGTGTAGGG + Intronic
1121513346 14:94530936-94530958 CCTTCATACCAGGAAGTGGTGGG - Intergenic
1122021929 14:98845105-98845127 CCTTCTAACCAAGAAGCCTTGGG - Intergenic
1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG + Exonic
1127919297 15:63480836-63480858 CCTTCCAACAATGAAGTATCAGG - Intergenic
1130045368 15:80440136-80440158 CCTTCCAACCTAGATGTTCTGGG + Intronic
1131454337 15:92571427-92571449 CTTTCCAAGCAAGAAGGTTTTGG + Intergenic
1131454347 15:92571506-92571528 CTTTCCAAGCAAGAAGGTTTTGG + Intergenic
1131454356 15:92571585-92571607 CTTTCCAAGCAAGAAGGTTTTGG + Intergenic
1131976146 15:97947614-97947636 CCTTTCAGGCAATAAGTGTTGGG + Intergenic
1133294862 16:4746735-4746757 CCCTCCAGCCTAGACGTGTTGGG - Intronic
1134607984 16:15586397-15586419 CCTGACATCCAAGAAGTATTTGG - Intronic
1139170349 16:64623812-64623834 CTTTACAAGCCAGAAGTGTTTGG - Intergenic
1140631525 16:76858547-76858569 CCTTGCAATCCAGAAGTGATTGG + Intergenic
1143406268 17:6679053-6679075 TCTTACAACAAAGAAGTATTCGG + Intergenic
1148827503 17:50404759-50404781 ACTTCTAACCCAGAAGGGTTGGG + Intergenic
1149274460 17:55017781-55017803 GCTCCCAACCCAGAAGGGTTGGG + Intronic
1149433710 17:56616244-56616266 CCTTCCAACAAACAATTGTCTGG - Intergenic
1150181983 17:63132410-63132432 CCATACAACCAAGAAGAGTAAGG + Intronic
1150814345 17:68380865-68380887 CCTGCCAACCAAGTGGTCTTGGG - Intronic
1155228429 18:23750718-23750740 CCTTGGAACCAGGAAGTGTGAGG + Intronic
1156288731 18:35725182-35725204 CCTTACAAGCCAGAAGAGTTGGG + Intergenic
1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG + Intergenic
1157604904 18:48920377-48920399 CCTTCCCTCCAAGAAGGATTTGG - Exonic
1159460910 18:68721659-68721681 ACTTCCAACCAAGCATAGTTTGG - Intronic
1164496248 19:28765519-28765541 CCTTACAAGCCAGAAGTGATTGG + Intergenic
1166054401 19:40279795-40279817 TCCCCCAACCAGGAAGTGTTGGG - Intronic
1166459554 19:42974133-42974155 CCCTCCAGCCAATGAGTGTTGGG - Intronic
1168030499 19:53675929-53675951 CCTTCCAACCTAGAACTCCTGGG + Intergenic
925668341 2:6286057-6286079 CCTTCCTACCAAGAAGACTGAGG + Intergenic
925677079 2:6374048-6374070 ACTTCCAACCAAGCAGTAATGGG - Intergenic
926639358 2:15219050-15219072 TCATCCAACAAACAAGTGTTAGG - Intronic
928476121 2:31629571-31629593 ACTCCCAACCCAGAAGGGTTGGG - Intergenic
928676733 2:33658116-33658138 GCTTCCAACCCAGAAGGGTTGGG - Intergenic
929301456 2:40308462-40308484 CCCTCAAACCACGAAGTCTTTGG - Intronic
930356091 2:50322294-50322316 TCTTCCAATCACGAAGTATTTGG - Intronic
931163469 2:59719505-59719527 CCTGCCACCCAAGTTGTGTTGGG + Intergenic
932384742 2:71321992-71322014 CCCTACAACCTAGAAGTGATTGG - Intronic
932463373 2:71897554-71897576 CCTTCCACCCAAAAACTGTCGGG + Intergenic
933175629 2:79169618-79169640 GCTCCCAACCCAGAAGAGTTGGG + Intergenic
935748449 2:106209902-106209924 GCTCCCAACCCAGAAGGGTTGGG - Intergenic
936141048 2:109940563-109940585 CCTTACAACCCAGAAGAGATTGG + Intergenic
936177736 2:110238508-110238530 CCTTACAACCCAGAAGAGATTGG + Intergenic
936203645 2:110430923-110430945 CCTTACAACCCAGAAGAGATTGG - Intronic
936387637 2:112044278-112044300 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
937319337 2:120951586-120951608 ACTTCCAAACAACAAGTTTTTGG + Intronic
942830406 2:180232637-180232659 CCTCCCAACCCAGAAGTGTTGGG - Intergenic
943644319 2:190392318-190392340 CCTCCCCACAAAGAATTGTTTGG - Intergenic
947491199 2:230595790-230595812 CCTTCCAAGCCAGAAGAGTGGGG + Intergenic
947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG + Intronic
1170118351 20:12885626-12885648 CCTTACAACCCAGAAGGGTAAGG - Intergenic
1172133633 20:32673055-32673077 CCTTACTACCAAGGAGTCTTGGG - Intergenic
1173227858 20:41172367-41172389 CCGCCCACCCAGGAAGTGTTGGG - Intronic
1175371416 20:58495580-58495602 AGTTCCAACCTAGACGTGTTGGG - Intronic
1178334234 21:31730235-31730257 GCTTCCAACCCTGAAATGTTTGG + Intronic
1178783549 21:35630061-35630083 CTTTCCCACCAAGAAGGGTCAGG + Intronic
1179974258 21:44854933-44854955 ACTTCCAGCCCAGAAGTCTTGGG + Intronic
1180949080 22:19713185-19713207 CCTCTCATCCAAGATGTGTTTGG - Intergenic
1182817121 22:33174854-33174876 CCTACCAACCAAAAAATGTCCGG + Intronic
951450856 3:22836719-22836741 CCCCCCAACCAAGAAATGTCAGG - Intergenic
951936592 3:28029393-28029415 CCTCACAACCAAGAATTATTGGG + Intergenic
952675881 3:36029722-36029744 CCTTCCAACTCAGAAATGTCAGG - Intergenic
953867710 3:46598733-46598755 CCTTCCAACTATGATGTGATGGG + Intronic
956449030 3:69355364-69355386 CCTTCCAAACAAGAAGACTCAGG - Intronic
959249026 3:103916546-103916568 CATTACAATCAAGAAGAGTTAGG - Intergenic
960695916 3:120396152-120396174 CCTTCCACCTATGAAGTGGTGGG + Exonic
960995526 3:123337827-123337849 CCTTTCAACAAATAAGTATTAGG - Intronic
962017081 3:131452866-131452888 CCTTCCCACAAGGAAGTATTGGG + Intergenic
968391518 4:196745-196767 ACTCCCAACCCAGAAGGGTTGGG + Intergenic
972099342 4:35392951-35392973 CCCTCCTACCTAGAAATGTTAGG + Intergenic
972553935 4:40162249-40162271 CCTTCGCCCCCAGAAGTGTTGGG - Intergenic
973612748 4:52652274-52652296 CATTCCAACCAAGCAGCGTTTGG - Intronic
976393470 4:84530534-84530556 CCTTCCAACTAAGAAGTGATAGG - Intergenic
977618336 4:99109228-99109250 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
977623341 4:99162863-99162885 CATTCCAAAAAAAAAGTGTTTGG - Intergenic
980443909 4:132882988-132883010 GCTCCCAACCCAGAAGGGTTGGG - Intergenic
981219325 4:142213260-142213282 CCTGCCACCCAACAGGTGTTGGG + Intronic
981691170 4:147510994-147511016 TCTGCCAAACAAGAAATGTTAGG - Intronic
983667338 4:170196374-170196396 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
986610649 5:9563687-9563709 CCTACCAACCAGGAATTCTTGGG + Intergenic
987366562 5:17153823-17153845 CCTTCCAGGCCAGAAGTGCTGGG - Intronic
992293593 5:75305150-75305172 GCTTCCAACCCAGAAGGGTTGGG - Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
994385223 5:99122993-99123015 CCTGCCAACCAAGAAGCCCTTGG - Intergenic
994436681 5:99743746-99743768 CCTTCCAACCAAAACGTGGAAGG + Intergenic
999417399 5:151410835-151410857 CCTCCCAACCAAGAATTATCTGG - Intergenic
1000792039 5:165619904-165619926 TTGTACAACCAAGAAGTGTTAGG - Intergenic
1002712041 5:181201168-181201190 CCCTACAACCAAGAAGTATCTGG - Intronic
1004236453 6:13879034-13879056 GCTCCCAACCCAGAAGGGTTGGG - Intergenic
1004401350 6:15291635-15291657 CCTTCCAGCCCAGTAGTGGTGGG + Intronic
1004980767 6:21021034-21021056 TCTTCCAAGCAAGAACTGTATGG + Intronic
1005523349 6:26620636-26620658 CATTCCACCAAAGAAATGTTAGG - Intergenic
1005653290 6:27904981-27905003 CTTTCCATCCAAAAAGTGTATGG - Intergenic
1008185623 6:48387181-48387203 CCTTCCAAGCCAGAAGGGATTGG - Intergenic
1009419796 6:63452936-63452958 CTTTCCAACCAAGTGCTGTTTGG + Intergenic
1011190231 6:84720197-84720219 GCTCCCAACCCAGAAGGGTTGGG + Intronic
1011210369 6:84949719-84949741 CCTACAAGCCAAAAAGTGTTGGG - Intergenic
1013543177 6:111131671-111131693 GCTCCCAACCCAGAAGGGTTGGG - Intronic
1014693644 6:124592496-124592518 CCTTTCAACAGTGAAGTGTTAGG - Intronic
1014900454 6:126957485-126957507 CATTCCAACCAATTTGTGTTTGG + Intergenic
1015854485 6:137608795-137608817 CCTCCCAACCAATAAGGGGTTGG + Intergenic
1018299797 6:162389094-162389116 CATTCAAAACAAGAAGTGATCGG - Intronic
1022597098 7:31723255-31723277 CCAACCAACCAAGAGGTGTCAGG - Intergenic
1027151679 7:75738337-75738359 CAATGCAACCAAGAAGTGATCGG + Intronic
1028473306 7:91227648-91227670 CCTGCCAATCAGGAAGAGTTTGG + Intergenic
1031930593 7:127681715-127681737 CCTTTCAACAAAAATGTGTTGGG - Intronic
1032093057 7:128921475-128921497 CCATCCAACAAGGAAGTATTGGG - Intergenic
1032725432 7:134586394-134586416 GCTCCCAACCCAGAAGGGTTGGG - Intergenic
1035042860 7:155943352-155943374 CCTTCCACCTGGGAAGTGTTGGG + Intergenic
1036437818 8:8751266-8751288 CCTTCTCACCCAGGAGTGTTGGG - Intergenic
1038697776 8:29821276-29821298 TCTTCCAACCAAGGAGAGATGGG - Intergenic
1041628294 8:60056172-60056194 CCTTCCAACCCTAACGTGTTAGG + Intergenic
1042859362 8:73297004-73297026 CCTTCCTCCCATGAAGTCTTTGG - Intronic
1046826584 8:118698665-118698687 TCTTCCAAACAAGTAGGGTTTGG + Intergenic
1046956663 8:120069270-120069292 CCTTCCAACCAAGATTGGCTAGG + Intronic
1047957168 8:129984741-129984763 CCCTCCAACCACCAAGTGGTGGG + Intronic
1051252963 9:15180756-15180778 CCTTCCCACCTTGAACTGTTAGG - Intronic
1052832103 9:33224015-33224037 CCTTACAACAAAGAATTATTAGG + Intronic
1055875238 9:80934256-80934278 CCTCCCTGCCAAGAACTGTTTGG - Intergenic
1056575328 9:87851918-87851940 CCTTCCAACAAGGGACTGTTGGG - Intergenic
1057136940 9:92697848-92697870 CCTTACAAACAAGAAGAGATTGG - Intergenic
1057260026 9:93577803-93577825 CCTTCCCACCAAGAAGTAAATGG + Intronic
1057566257 9:96168528-96168550 CCTTTAAACCAAGAGGTTTTTGG - Intergenic
1058315174 9:103555802-103555824 CCCTACAATCAAGAAGAGTTTGG + Intergenic
1059739290 9:117134050-117134072 CCTTCCTACCAAGGATTTTTGGG - Intronic
1060950057 9:127595836-127595858 CCTTCCCATCAGGAAGTGGTGGG - Intergenic
1061721564 9:132555022-132555044 CCATCCAGCCAAGATTTGTTTGG + Intronic
1186186927 X:7029786-7029808 CCCTCCAGCCAATGAGTGTTGGG - Intergenic
1188030206 X:25255322-25255344 CCTTCCAACCAAGAAGAAAAAGG - Intergenic
1188513241 X:30958947-30958969 CCTCGCAACAAAGAAGTGTTAGG - Intronic
1189347854 X:40255869-40255891 CCTTCCCACCCAGCAGTGGTTGG - Intergenic
1189548565 X:42069951-42069973 TCTGACAACCAAGAAGTGTTTGG + Intergenic
1190642258 X:52492293-52492315 CCTTCCCATCAAGAGCTGTTTGG + Intergenic
1190645415 X:52520574-52520596 CCTTCCCATCAAGAGCTGTTTGG - Intronic
1192854693 X:74996663-74996685 CCTACCAACCAAAAAGAGTCCGG - Intergenic
1192940278 X:75904349-75904371 GCTCCCAACCCAGAAGGGTTGGG + Intergenic
1193172284 X:78349794-78349816 GCTCCCAACCCAGAAGGGTTGGG + Intergenic