ID: 1085772021

View in Genome Browser
Species Human (GRCh38)
Location 11:79334234-79334256
Sequence ATAGTCTGGCAGGACTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085772016_1085772021 26 Left 1085772016 11:79334185-79334207 CCAGGTAAAGAACTGCTGCTGAG 0: 1
1: 0
2: 1
3: 19
4: 191
Right 1085772021 11:79334234-79334256 ATAGTCTGGCAGGACTCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 128
1085772018_1085772021 -7 Left 1085772018 11:79334218-79334240 CCTTACAGTGTCGCATATAGTCT 0: 1
1: 0
2: 1
3: 2
4: 58
Right 1085772021 11:79334234-79334256 ATAGTCTGGCAGGACTCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085772021 Original CRISPR ATAGTCTGGCAGGACTCAGC TGG Intronic
901873468 1:12152365-12152387 GTAGGCTGGCAGGGCTGAGCCGG + Intergenic
905020278 1:34806001-34806023 AGATTCTGACAGGACTCAGCAGG + Intronic
905230202 1:36510404-36510426 ACAGCCTGGCAGGACTCGCCAGG - Intergenic
908449484 1:64238115-64238137 AAATTCTGGCTGGACACAGCGGG + Intronic
910025809 1:82650172-82650194 ATAGACTTTTAGGACTCAGCAGG + Intergenic
910265273 1:85331918-85331940 ACAGCCTGGCTGGAATCAGCTGG + Intronic
910440185 1:87243746-87243768 ACAGTCTGGCATGACTCAGTAGG - Intergenic
910547385 1:88433344-88433366 ATAGTCTGGCAGTACTCCCCAGG + Intergenic
918689862 1:187466633-187466655 AGAGGCTGGCAGAAATCAGCTGG - Intergenic
1062997483 10:1880637-1880659 AAAGTCTGTCAGGGCCCAGCCGG - Intergenic
1066055373 10:31675894-31675916 AAATTTTGGCAGGGCTCAGCTGG + Intergenic
1070557220 10:77537867-77537889 ATTTTTTGGCAGGGCTCAGCAGG + Intronic
1075615119 10:123885166-123885188 GTTGTCTGGCAGGACTCAACGGG + Intronic
1075986773 10:126794652-126794674 ATAGACTTGGAGGACTCAGTGGG + Intergenic
1077438604 11:2557559-2557581 ACAGTCTGGCAGGGCTCAGTGGG + Intronic
1080642309 11:34165051-34165073 AGCATCTGGCAGGACCCAGCAGG - Intronic
1084402553 11:68953337-68953359 AGAGTCTGGCCGGACGCAGTAGG - Intergenic
1085772021 11:79334234-79334256 ATAGTCTGGCAGGACTCAGCTGG + Intronic
1087523474 11:99275711-99275733 ATAGTCTGTCATCACTCAGCAGG + Intronic
1088218866 11:107545451-107545473 GGAGTCAGGCAGGACTCAACAGG + Intronic
1088729253 11:112666427-112666449 ATGGGCTGGCAAGGCTCAGCTGG + Intergenic
1088805140 11:113345516-113345538 ACAGTGTGGGAGGGCTCAGCAGG - Intronic
1089468334 11:118700724-118700746 GTAGTTTGGCAGGGCTCAGTTGG - Intergenic
1090009552 11:123034177-123034199 AGACTGGGGCAGGACTCAGCTGG + Intergenic
1090203222 11:124870490-124870512 AAAGACAGGCAGGACCCAGCAGG - Intronic
1091171160 11:133520840-133520862 GTTCTCTGGCAGGGCTCAGCTGG + Intronic
1091809644 12:3385401-3385423 ACAGTCTGGGAGGAATCACCTGG - Intronic
1092028713 12:5265315-5265337 AAATTCTGGCAGGGCTCAGAGGG - Intergenic
1092033417 12:5309144-5309166 AAAGTCTGGCAGCCGTCAGCAGG + Intergenic
1092680082 12:10969162-10969184 AGAGTCTGGCTGGAGACAGCCGG - Intronic
1092850841 12:12624971-12624993 AGAGTCTGGCTGGAGACAGCTGG - Intronic
1095984579 12:47990913-47990935 ACTGACAGGCAGGACTCAGCAGG - Intronic
1096114700 12:49049034-49049056 AGGGACTGGCAGGACTCAGAGGG + Intronic
1096779032 12:53981775-53981797 ATACTCTGGGAGGATCCAGCGGG - Intergenic
1098854491 12:75636986-75637008 GAAGTCTGGCAGGTCTCATCAGG + Intergenic
1099645588 12:85350549-85350571 ATAGCCTGACAGGAGGCAGCTGG + Intergenic
1104103108 12:125634219-125634241 GTAGTCTGGCAGTACTCTGTAGG - Intronic
1108182912 13:47858649-47858671 ATAGTCTAGCACGGCTCAACTGG + Intergenic
1110963894 13:81666452-81666474 ATAGTCAGGCAGGCCTAAACTGG - Intergenic
1113948974 13:114060667-114060689 AGAGGCGGGCAGGACGCAGCTGG + Intronic
1122233200 14:100317523-100317545 AGTGTCTGGGAGGACTGAGCGGG + Intergenic
1131779881 15:95844634-95844656 AGTTTCTGGAAGGACTCAGCTGG - Intergenic
1132285391 15:100658703-100658725 AGAGTCTGTCAGCACTCAGGAGG + Intergenic
1133834129 16:9351326-9351348 GTAGTCAGGCAGTACTCACCAGG - Intergenic
1135468305 16:22706427-22706449 ATAGTCTGGCAGGAGGCTGTGGG - Intergenic
1135879589 16:26241027-26241049 GTAGTCTGGCAGAACTCCCCAGG + Intergenic
1137442914 16:48511312-48511334 AAAGGCAGGCAGGACACAGCGGG - Intergenic
1138852103 16:60641631-60641653 AAAGTCTGGCTGGAAACAGCTGG - Intergenic
1143864143 17:9911696-9911718 AGAGGCTGCCAGGACTCTGCTGG - Intronic
1146851633 17:36226926-36226948 CTAGTGTGGAAGGACTCAGTGGG + Intronic
1146867542 17:36350802-36350824 GTAGTGTGGAAGGACTCAGTGGG + Intronic
1147070418 17:37951416-37951438 GTAGTGTGGAAGGACTCAGTGGG + Intergenic
1147081942 17:38030941-38030963 GTAGTGTGGAAGGACTCAGTGGG + Intronic
1147097891 17:38154906-38154928 GTAGTGTGGAAGGACTCAGTGGG + Intergenic
1151725547 17:75881776-75881798 ACAGACTGCCAGGACTCAGGCGG + Intronic
1152392162 17:80009527-80009549 ATACTCTGGCTGGACTCCCCAGG + Intronic
1158571739 18:58602180-58602202 GTAGTCTGGATGAACTCAGCTGG + Intronic
1163034608 19:14563606-14563628 ACAGCCTGGCAGGGCTCAGCCGG - Intronic
1164771252 19:30810969-30810991 AAAGAAAGGCAGGACTCAGCGGG - Intergenic
1166322676 19:42028382-42028404 AGAGCCTGGCAGGGCGCAGCAGG - Intronic
1167140477 19:47647345-47647367 AGAGTCTGGCTGGTCTCAGTAGG - Intronic
926347602 2:11962649-11962671 ATAGTATGGCAGAGCTCATCAGG + Intergenic
927084288 2:19659212-19659234 AAAGTTTGGCAGCACTCATCTGG + Intergenic
927308325 2:21599406-21599428 ATAGTCTGGCAGAGGTCAGCAGG - Intergenic
931240972 2:60452422-60452444 CTAGGCTGGAAGGACTCTGCAGG + Intronic
933138793 2:78768183-78768205 ATAGTCAGAAAGGACTCAGAAGG - Intergenic
935582126 2:104765485-104765507 AAAGTCTGGAAGCACACAGCAGG + Intergenic
936548306 2:113412031-113412053 AAAGGCTGGCAGGATCCAGCAGG + Intergenic
942229560 2:173847526-173847548 ATAGCCTGGCAGGAGGGAGCTGG + Intergenic
943996431 2:194771928-194771950 AAAGTCTGGTAGAACTCTGCTGG + Intergenic
945307262 2:208269922-208269944 ATATTCTGGGAGGAACCAGCAGG - Intronic
945696976 2:213119137-213119159 AAAGGCAGGCAGGACTGAGCAGG + Intronic
947271058 2:228336050-228336072 ATAGGCTGACTGGAATCAGCAGG - Intergenic
1169084602 20:2818941-2818963 GTAGCCTGGTAGGACTCAGATGG - Intronic
1169441576 20:5638201-5638223 ATAGGCTGACTGGGCTCAGCAGG + Intergenic
1170159169 20:13295215-13295237 ATACTCTGGGAGGAAACAGCAGG - Intronic
1170819654 20:19745758-19745780 ATAGGTTGGCTGGGCTCAGCTGG + Intergenic
1170858152 20:20076514-20076536 GAACTCTGGCAGGGCTCAGCTGG - Intronic
1171277149 20:23867229-23867251 ACAGTCTGGCAGGGATCTGCAGG - Intergenic
1174086312 20:48010419-48010441 GTTGTCTGGAAGGACTCATCTGG + Intergenic
1176428041 21:6560734-6560756 GGAGGCTGGCAGGAGTCAGCGGG - Intergenic
1177895597 21:26853230-26853252 TCAGTCTGGCAGGAAACAGCAGG - Intergenic
1179703532 21:43169051-43169073 GGAGGCTGGCAGGAGTCAGCGGG - Exonic
1181852573 22:25760807-25760829 ATGGTCAGGCAGGACCCTGCAGG - Intronic
950751447 3:15131944-15131966 ATAGACTTGCAAGACACAGCTGG - Intergenic
954777130 3:53029735-53029757 TTAGTCTCCCAAGACTCAGCTGG + Intronic
957181312 3:76881883-76881905 ACTGTTTGGCTGGACTCAGCAGG + Intronic
958897924 3:99850680-99850702 AAAAGCTGGCAGCACTCAGCCGG - Exonic
962425698 3:135267499-135267521 ACTGTGTGGCAGGACTCAGGTGG - Intergenic
962906582 3:139808960-139808982 GCAGTCTGGCTGGGCTCAGCTGG - Intergenic
965741743 3:171882510-171882532 ATATTCAGGCAGGGCTCAGCTGG - Intronic
968487923 4:872823-872845 CTAGTCTGGCAGGAGCCTGCGGG - Intronic
968909778 4:3471765-3471787 ATTGTCTGGAAAGCCTCAGCTGG + Intronic
969740357 4:9020909-9020931 ATAGACTTGCAAGACACAGCTGG - Intergenic
976016460 4:80560666-80560688 GTAGTCTGGCAGTACTCCACAGG + Intronic
977141670 4:93380849-93380871 ATATTCAGGCAGGATTCAGTGGG + Intronic
977303180 4:95291954-95291976 ATGTACTGGCAGGATTCAGCAGG - Intronic
979779112 4:124626974-124626996 ATAGTTTGCCTGGACTCAGTGGG - Intergenic
985097176 4:186424423-186424445 ATAGGAAGGCAAGACTCAGCTGG - Intergenic
986065048 5:4227239-4227261 AGAGGCAGGCAGGTCTCAGCTGG - Intergenic
986639185 5:9855235-9855257 ATGGTCAGGCAGGACTAAACTGG - Intergenic
988726125 5:33928155-33928177 ATAGTCTGGGTGGTGTCAGCTGG + Intergenic
989653122 5:43715585-43715607 AAATTCTGGCAGGGTTCAGCTGG - Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
997732909 5:136193663-136193685 ACAGACCGGCAGGACGCAGCCGG - Intergenic
1002086658 5:176780186-176780208 ACGGTGTTGCAGGACTCAGCTGG + Intergenic
1002179156 5:177421123-177421145 GAATTCAGGCAGGACTCAGCAGG + Intronic
1004804760 6:19190778-19190800 ATAGTCTCGCAGGAAATAGCTGG - Intergenic
1009761048 6:68006541-68006563 ATAGTTTGGGAGGACTAGGCAGG - Intergenic
1011908193 6:92400037-92400059 TTTTTCTGGCAGGACCCAGCAGG - Intergenic
1013821760 6:114162501-114162523 TTAATCTGGCAGGACTAGGCAGG - Intronic
1014069755 6:117167886-117167908 AGAGCCTGGCTGGACACAGCAGG - Intergenic
1014513237 6:122350643-122350665 ATACTCTGGCAGGACTCAAGAGG - Intergenic
1016580873 6:145628406-145628428 AGAGTCTACCAGGCCTCAGCAGG - Intronic
1018870073 6:167775921-167775943 AAAGTCTATCAGGACACAGCAGG - Intergenic
1020951029 7:14677603-14677625 CTGGTCAGGCAGGACTCACCAGG - Intronic
1022099733 7:27161885-27161907 CCAGGCTGGCAGGACTCCGCGGG + Intergenic
1024891721 7:54211229-54211251 ATAGTCTGGCAGTGCTCCTCAGG + Intergenic
1026231946 7:68491471-68491493 AGAAGCTGGCAGGAATCAGCAGG - Intergenic
1028479423 7:91288466-91288488 ATAGTCAAGTAGGACCCAGCAGG - Intergenic
1028752615 7:94397557-94397579 AAAGTATGGCAGGGATCAGCAGG - Intronic
1034673298 7:152872923-152872945 ATAGTCAGGCAGGTCAGAGCAGG - Intergenic
1035406502 7:158602121-158602143 GGAGTCTGCCAGGACTCAGGCGG + Intergenic
1035460194 7:159033929-159033951 ATGACCTGGGAGGACTCAGCAGG - Intronic
1035891207 8:3345150-3345172 ACAGTGTGTCAGGACCCAGCAGG - Intronic
1036245560 8:7113469-7113491 ATAGACTTGCAAGACACAGCTGG - Intergenic
1037966569 8:23138625-23138647 ATAGTCTGCCGAGACTCTGCTGG - Intronic
1038223212 8:25630410-25630432 ATAGACTGAAAGGATTCAGCTGG + Intergenic
1038525602 8:28270483-28270505 ACAGTCTGGAAGGTCTCAACAGG + Intergenic
1039585277 8:38702047-38702069 GTAGTCTGGCAGGCATGAGCAGG - Intergenic
1039852558 8:41382676-41382698 AAAATCTGGCATGACTCAACTGG + Intergenic
1042657447 8:71115454-71115476 AAAGTCTTCCAGGTCTCAGCAGG + Intergenic
1049595157 8:143480053-143480075 CGAGGCTGGCAGCACTCAGCAGG - Intronic
1053727257 9:41016756-41016778 AAAGGCTGGCAGGATCCAGCAGG - Intergenic
1054701259 9:68415356-68415378 AAAGGCTGGCAGGATCCAGCAGG + Intronic
1187567117 X:20461830-20461852 ATAGTCTGGAACCACTCAGGCGG + Intergenic
1195336726 X:103862204-103862226 ATAGTGTGGCTGGAGTCAGTTGG - Intergenic
1196625381 X:117871675-117871697 GTAGTCTGGCAGAACTCCTCAGG + Intergenic
1202237520 Y:22729008-22729030 ATGGTGTTGCAGGACTCAGAAGG - Intergenic