ID: 1085773226

View in Genome Browser
Species Human (GRCh38)
Location 11:79342908-79342930
Sequence TTCCTGTCCTTGTCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085773221_1085773226 24 Left 1085773221 11:79342861-79342883 CCTGCGTCCCTGGCGCCCTGCAG 0: 1
1: 1
2: 2
3: 60
4: 1688
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1085773223_1085773226 16 Left 1085773223 11:79342869-79342891 CCTGGCGCCCTGCAGCTTTGCAT 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1085773224_1085773226 9 Left 1085773224 11:79342876-79342898 CCCTGCAGCTTTGCATGAATGTG 0: 1
1: 0
2: 2
3: 14
4: 172
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1085773220_1085773226 28 Left 1085773220 11:79342857-79342879 CCTGCCTGCGTCCCTGGCGCCCT 0: 1
1: 0
2: 2
3: 57
4: 530
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1085773225_1085773226 8 Left 1085773225 11:79342877-79342899 CCTGCAGCTTTGCATGAATGTGA 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1085773218_1085773226 30 Left 1085773218 11:79342855-79342877 CCCCTGCCTGCGTCCCTGGCGCC 0: 1
1: 0
2: 5
3: 44
4: 421
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1085773219_1085773226 29 Left 1085773219 11:79342856-79342878 CCCTGCCTGCGTCCCTGGCGCCC 0: 1
1: 0
2: 1
3: 37
4: 432
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1085773222_1085773226 17 Left 1085773222 11:79342868-79342890 CCCTGGCGCCCTGCAGCTTTGCA 0: 1
1: 0
2: 3
3: 19
4: 255
Right 1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085773226 Original CRISPR TTCCTGTCCTTGTCCAAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900346546 1:2213113-2213135 CCCCTTTCCTTCTCCAAAACTGG - Intergenic
900940056 1:5792941-5792963 TTCCTCTCCTTGGCCAAGTCTGG + Intergenic
904034916 1:27553395-27553417 GTCCAGTCCTTGTCCAAAGTAGG - Intronic
906841879 1:49147925-49147947 ATCCTGTCTGTGTCCAAAGCAGG + Intronic
907293968 1:53437853-53437875 TTCCTGTTCATGTCCATTACAGG - Intergenic
908143315 1:61210645-61210667 TTCCAGTCTTTGTCCAATAATGG - Intronic
910494388 1:87810250-87810272 TACATGTCTTTGTCCCAAACTGG - Intergenic
910627526 1:89324227-89324249 TTTCTATCCTTGTCCTAAACAGG + Intergenic
914690750 1:150024509-150024531 TTAGTGTCCTTCTCAAAAACTGG + Intergenic
915848844 1:159299342-159299364 TTTATGTCCTTCTCCAAAACTGG - Intronic
918559173 1:185843820-185843842 TTCCTATCTTTGTTGAAAACAGG + Intronic
922230530 1:223681813-223681835 TTACTGTCCATGTTCAAAATTGG - Intergenic
922908193 1:229192468-229192490 TTTCTATCTTTGTCCTAAACAGG + Intergenic
1063171668 10:3515193-3515215 TTGCTATCCTTGTCCACAAAGGG + Intergenic
1065516123 10:26526016-26526038 TTCCTGTCCTTCTCTGAAGCAGG - Intronic
1069024358 10:63523267-63523289 ATCCCTTCCTTGTCCAACACTGG - Intronic
1074871034 10:117576236-117576258 TTCCTCTTCTTTTCCAAACCTGG + Intergenic
1079148339 11:17874700-17874722 ATCCTGTCCTTGAACAAATCTGG + Intronic
1080756480 11:35204838-35204860 TTCCTGTTCTTATTCATAACTGG - Intronic
1082786121 11:57317887-57317909 TTCCTGTCCTCGTCCCTCACAGG - Exonic
1085694587 11:78693183-78693205 TGCCTTTCCTTGTCCAAATGAGG + Intronic
1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG + Intronic
1086070232 11:82791479-82791501 TTCCTGTCCTTGACCTAAATAGG + Intergenic
1088565038 11:111162417-111162439 TTCCAGTCCTCCTCCAAGACAGG + Intergenic
1091972352 12:4797885-4797907 TTCCTTTCCTTCTCCCAGACTGG + Intronic
1096544195 12:52326266-52326288 TTCCTTTCCTTTTTCATAACTGG - Intergenic
1097876434 12:64648204-64648226 TCCCTGACCTGGTCCAAATCTGG - Intronic
1098429085 12:70400023-70400045 TTTCTGTCCTTGTGCCAAATTGG + Intronic
1099159098 12:79217608-79217630 TTCCTTTCCTTCTCCAGGACTGG - Exonic
1104137105 12:125951024-125951046 TTCCTGTCCCTGACCACAACTGG - Intergenic
1105446748 13:20463634-20463656 TACCTGTCCTTGTTTAAAAAAGG - Intronic
1106518159 13:30472756-30472778 TTCCTCTCCTTTTCCGAAACTGG - Intronic
1106870283 13:34011836-34011858 CTCCTGTCAGTGTCCAAAAGAGG + Intergenic
1107719228 13:43230365-43230387 TTCCTGCCCCTGTCCAAAGCAGG - Intronic
1111032688 13:82625933-82625955 TTCATGTTCTTGTCAAACACTGG + Intergenic
1112522341 13:100107951-100107973 TGCCTGTCCTTTTCCAGAGCTGG + Intronic
1113170604 13:107498417-107498439 TTCCTGTCATTGTTAAAAAATGG + Intronic
1114642602 14:24233407-24233429 TGCCTGTCCTTGTCCTAATATGG + Intronic
1115433895 14:33351759-33351781 GTCATGCCCTTGTTCAAAACTGG - Intronic
1116468330 14:45258481-45258503 TTCCTGTCTTTTACCAAATCTGG + Intergenic
1117649324 14:57886584-57886606 CTCCTTTCCTTTACCAAAACTGG + Intronic
1118953215 14:70453974-70453996 TTCCTTTTCTTGTCCTAGACTGG - Intronic
1120327889 14:83052622-83052644 TCCCAGTCCTTGACCATAACAGG + Intergenic
1122145369 14:99685378-99685400 TTCCTCTGCTTGTCTCAAACAGG + Intronic
1125053753 15:35333546-35333568 TTAATAACCTTGTCCAAAACTGG + Intronic
1125144695 15:36453352-36453374 TCCATGTGCTTTTCCAAAACAGG + Intergenic
1126312894 15:47337135-47337157 TTCCAGTCACTTTCCAAAACTGG - Intronic
1126348653 15:47721883-47721905 ATCCTGTCCTTGGCTACAACAGG + Intronic
1126598956 15:50409318-50409340 TTTCTTTTCTTTTCCAAAACTGG + Intergenic
1128901250 15:71424394-71424416 TTCCAGTCCCTGTCAAAAAATGG - Intronic
1129452825 15:75660204-75660226 TTCCTGTACTGGGCCAAGACTGG - Exonic
1131826398 15:96325102-96325124 TTCTTGTCCTTGTCTTAAACAGG - Intergenic
1134266303 16:12695662-12695684 TGCCTGTGATTGGCCAAAACCGG - Intronic
1134668378 16:16036557-16036579 TTCCAGTTCTTTACCAAAACAGG - Exonic
1135537666 16:23306599-23306621 TTCTTGTCCTTGGCCAGAAAAGG - Intronic
1140482998 16:75272606-75272628 TTCCTCTCCATGTGTAAAACAGG + Intergenic
1140898479 16:79347109-79347131 TTCCTGTTCTTGTGAGAAACTGG + Intergenic
1145734331 17:27216403-27216425 TTCATGTACTTATCCAAACCAGG + Intergenic
1147010026 17:37438281-37438303 TACCTGCCTTAGTCCAAAACCGG + Intronic
1147020704 17:37530333-37530355 TTCCTGACCTTGTCCTAATATGG - Intronic
1148487144 17:47997835-47997857 TTCCTGGACTTGTCTAAAAGGGG + Intergenic
1148656989 17:49292235-49292257 TTCCAGTTCTCCTCCAAAACTGG - Intronic
1150641495 17:66952838-66952860 TGCCTGTCCTGATCCAAGACAGG + Intergenic
1155725497 18:29076829-29076851 TTCCTGTCCTTGTCCCTCCCAGG + Intergenic
1155788425 18:29932288-29932310 TTCTTGTTCTTTTTCAAAACTGG - Intergenic
1156001650 18:32391557-32391579 TTTCTGTCTTTGTGGAAAACTGG - Intronic
1161635831 19:5388565-5388587 TTCCCTTCCTTTTCCAAGACAGG - Intergenic
1162686584 19:12390661-12390683 TTCATGTCCTTGAAGAAAACGGG + Exonic
1162690916 19:12430351-12430373 TTCATGTCCTTGAAGAAAACGGG + Exonic
1165194162 19:34088181-34088203 TTCCTGTCCTTGGCCACTTCTGG + Intergenic
1165356500 19:35307723-35307745 TTTCTTTCATTTTCCAAAACAGG - Intronic
1165661727 19:37586740-37586762 TTCTTTTCCTTGTCCAGCACTGG - Exonic
1166571781 19:43801869-43801891 TTCCTGTCCTAGCCCACAATGGG + Intronic
928348995 2:30529703-30529725 TTCCAGTCCTAGCACAAAACAGG + Intronic
929129482 2:38552921-38552943 TTCCTATGCTTATCGAAAACTGG + Intergenic
930895208 2:56438367-56438389 TTAGTGTCCTTTTCCAGAACAGG + Intergenic
933023855 2:77228722-77228744 GTCCTGTCCTTGTTCATATCAGG + Intronic
935203513 2:100878414-100878436 CTCATGTCCTTGTCCAACGCTGG - Intronic
941844919 2:170122690-170122712 TTCCTGGCCATGTCCTACACTGG - Intergenic
942399347 2:175584931-175584953 TTCCTGTCATTGCCAAAAATGGG - Intergenic
942532048 2:176921512-176921534 TTCCTGTCATTTTCAACAACAGG + Intergenic
943378505 2:187112715-187112737 TTACTGTCTTAGTCCAAAGCTGG - Intergenic
947524878 2:230871812-230871834 TTTCTGTCCTTTTCCTAAGCAGG + Intronic
947746791 2:232512088-232512110 CTCCTGTCCTTGGCCTAAAACGG + Intergenic
948621107 2:239235276-239235298 TTTCTGTCATTTTCCAAACCCGG - Intronic
1168784628 20:527560-527582 TTCCCATCTTTCTCCAAAACAGG + Intronic
1169271405 20:4202246-4202268 TTCCAGTCCTTGTCAGAAACAGG + Intergenic
1171445089 20:25197018-25197040 TTTCTCTCCTTGGCAAAAACCGG - Intronic
1173598249 20:44274134-44274156 TTCTTGTCCTTGTCCAAGGATGG + Intronic
1174523827 20:51155576-51155598 TTCCTGCCCTTTCCCAAACCCGG + Intergenic
1174986740 20:55462640-55462662 TTCCTGTCTTTATCCAAGTCAGG - Intergenic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1180281735 22:10703277-10703299 TTACTATCATTTTCCAAAACAGG - Intergenic
1180848212 22:18995776-18995798 TTCCTGTGCTTTTACAAACCAGG - Intergenic
1183643867 22:39110835-39110857 TTCTCGTCCTTGCCCATAACTGG - Intergenic
952006372 3:28846858-28846880 TTCCTGTCCTGGTTCAGAACTGG + Intergenic
952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG + Intergenic
967996623 3:195171687-195171709 TTTCTCTCCTCTTCCAAAACAGG + Intronic
968314213 3:197709225-197709247 TTCCTGTTCTTATCGAAAAATGG + Intronic
969965639 4:10992498-10992520 TTCCTGTCTTTCCCCAAACCTGG + Intergenic
970362629 4:15325145-15325167 CTTCTGTCCATGTCCAGAACTGG + Intergenic
980614797 4:135205416-135205438 TTGCTATCCTTTTCCATAACAGG + Intergenic
981115018 4:140979800-140979822 TTCCGTTCATTGACCAAAACAGG - Intronic
985314540 4:188642573-188642595 CTCCTGCCCTTCTCCAAAGCAGG - Intergenic
990492482 5:56315894-56315916 TACCTGACCCTGTACAAAACTGG - Intergenic
990881273 5:60541789-60541811 ATCCTGTCCTGCACCAAAACAGG + Intergenic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
994475997 5:100270747-100270769 TTCCTTTCCCTGTCTAAAAGAGG + Intergenic
995640235 5:114248156-114248178 TTCCTGTCCATGTAAAAATCTGG - Intergenic
996623529 5:125540548-125540570 TTTCTTTTCTTGTCAAAAACTGG + Intergenic
999114630 5:149151807-149151829 TTCCTGGGCCTGTCCAACACAGG + Intronic
1000493388 5:161945339-161945361 TCCCTCTCCTTGTGTAAAACAGG + Intergenic
1001409193 5:171498225-171498247 TCTCTGTTCTTGTCCAAAGCTGG - Intergenic
1002046704 5:176545629-176545651 TTGGTGTCCTTGTCCAAAATGGG - Intronic
1005148660 6:22722279-22722301 TTCCTGTCTTTGTCATAAATAGG - Intergenic
1006083937 6:31582834-31582856 TTCCAGTCCTTGTCCTAGTCCGG - Intergenic
1007003577 6:38337775-38337797 TTCCTTCCCTTGTCCTACACTGG + Intronic
1010007590 6:71012211-71012233 TTCCTGTCCTTGTGACAAAATGG - Intergenic
1010836500 6:80594113-80594135 TGCCTGTCCGTGGCCTAAACTGG + Intergenic
1013045118 6:106477972-106477994 TTCCTGTCCCTGTACAAAGGAGG + Intergenic
1013365837 6:109437312-109437334 GTCCTGTCATGGTCCAAAAGAGG + Intronic
1013739611 6:113267361-113267383 TCCCTGGCCTTGTTCCAAACTGG - Intergenic
1016794383 6:148102194-148102216 TTCCTCTCCTTTTCCAAATGTGG - Intergenic
1017105331 6:150882367-150882389 TTCCTGTCCTTCCTGAAAACTGG + Intronic
1017898794 6:158703320-158703342 TTCCTGTCCCTGGCAAAGACGGG + Intronic
1019265906 7:117532-117554 CTCCTTTCCTTGACCAAACCCGG - Intergenic
1021136570 7:16971830-16971852 TTCCTGTCATATTCCAAAGCTGG + Intergenic
1022283990 7:28937841-28937863 TTCCTGTGCTTCGCCAAAGCGGG - Intergenic
1024971050 7:55070843-55070865 TTCCTTTCCTTTTTCAAGACTGG - Intronic
1025715637 7:63953137-63953159 TTCCTGGGCTTGTCTGAAACTGG - Intergenic
1026478499 7:70758781-70758803 TTACTGTACTTCTCCAAAATTGG - Intronic
1027404010 7:77839386-77839408 TTTCTGTGTTTGTCTAAAACAGG - Intronic
1028168826 7:87571236-87571258 TTCCTACCCCTGTCAAAAACAGG - Intronic
1028964078 7:96782092-96782114 TTCCTTTCCTGGTCTACAACTGG + Intergenic
1032885919 7:136138191-136138213 TTCCTTTGCTTGTCCCAAAATGG - Intergenic
1034081170 7:148278963-148278985 TTCCTGTCCTTGAACAAGCCAGG - Intronic
1034193768 7:149230329-149230351 CTCCTGTGCTCTTCCAAAACAGG - Intergenic
1035349915 7:158238597-158238619 TTACTTTCCTTGTCTTAAACGGG + Intronic
1036766506 8:11552791-11552813 TTCCTGTCCATGTCCACCCCAGG + Intronic
1037387674 8:18360803-18360825 TTCCAGGCCTTTTCCAAATCTGG + Intergenic
1037875347 8:22544002-22544024 TTCCTGACATTGTTCAAAATAGG + Intergenic
1038776423 8:30535099-30535121 TTCCAGTCCTTGACGAAAAAAGG - Intronic
1040447404 8:47509251-47509273 TTCCTGTTCTTGTAGAAATCCGG + Intronic
1042370878 8:67989096-67989118 TTTCTCTCCTTCTCCTAAACTGG - Intronic
1042598378 8:70473272-70473294 TACCTGTGATTGGCCAAAACTGG - Intergenic
1044086136 8:87944162-87944184 TTCCAGTCCACGTCCAGAACAGG + Intergenic
1045601656 8:103723816-103723838 TTCCTGTCCTTTTCCAGTGCTGG - Intronic
1048939339 8:139384829-139384851 TTCCTGTCATTTTTCAAATCAGG + Intergenic
1048987658 8:139743706-139743728 TTCCTGCCCTTCACCAACACCGG + Intronic
1050075028 9:1854350-1854372 TTTCTGTCCTGGCCCAAAATAGG + Intergenic
1053288801 9:36866615-36866637 CTCCTGTCCTTGTGCAGAACTGG - Intronic
1054910352 9:70449576-70449598 TTCCTGTCCTCCTCCAAGACTGG + Intergenic
1059314506 9:113412429-113412451 TTACTGTTCATGTCCAAAGCAGG + Intronic
1059398880 9:114056343-114056365 TGTCTGTTCTTGTCCAAAAGTGG + Exonic
1060695583 9:125706803-125706825 TTCCTGGCCATTTCCAGAACTGG - Intronic
1060918768 9:127406227-127406249 TTCCCGTCCTTGTCATAAAGGGG - Intronic
1188355552 X:29186398-29186420 TTCCTAGCCTTTTTCAAAACTGG - Intronic
1189230077 X:39445292-39445314 CTCCTGTCCTTGTCTAGACCTGG + Intergenic
1195124541 X:101793686-101793708 TTCCTTTATTTGTCCAAAAATGG + Intergenic
1196179328 X:112672680-112672702 TTCCTGTCAGTGTCTAAAATTGG - Intronic
1198330118 X:135614995-135615017 TTCCTGCCCCTGTCCCAAATTGG - Intergenic
1198336809 X:135674005-135674027 TTCCTGCCCCTGTCCCAAATTGG + Intergenic
1198362785 X:135912459-135912481 TTCCTGCCCCTGTCCCAAATTGG - Intronic
1199095257 X:143730862-143730884 TTCCTATTCTTGTCCTAAAAAGG + Intergenic
1199992414 X:152994627-152994649 TTCCTGTCGTTTCCCAAAGCAGG + Intergenic
1201385403 Y:13435482-13435504 TTACTGTCTTTGTCTGAAACCGG + Intronic