ID: 1085774539

View in Genome Browser
Species Human (GRCh38)
Location 11:79353305-79353327
Sequence CTGATAAAACAGATCTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085774535_1085774539 -5 Left 1085774535 11:79353287-79353309 CCTTCCCTTTAAATCTATCTGAT 0: 1
1: 0
2: 0
3: 19
4: 266
Right 1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG 0: 1
1: 0
2: 0
3: 20
4: 229
1085774537_1085774539 -10 Left 1085774537 11:79353292-79353314 CCTTTAAATCTATCTGATAAAAC 0: 1
1: 0
2: 2
3: 13
4: 281
Right 1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG 0: 1
1: 0
2: 0
3: 20
4: 229
1085774536_1085774539 -9 Left 1085774536 11:79353291-79353313 CCCTTTAAATCTATCTGATAAAA 0: 1
1: 0
2: 2
3: 46
4: 491
Right 1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG 0: 1
1: 0
2: 0
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085774539 Original CRISPR CTGATAAAACAGATCTTACA GGG Intronic
904866629 1:33584338-33584360 GAGATAACACAGACCTTACAGGG + Intronic
906646828 1:47481178-47481200 CTGTTCAGACACATCTTACATGG + Intergenic
908521043 1:64942518-64942540 ACAATAAAACTGATCTTACATGG + Intronic
909473681 1:76058069-76058091 CTGAGTAAACAGTTCTTATAAGG + Intergenic
910899992 1:92110076-92110098 CTCATAACACAGGTCTTCCAAGG + Intronic
911581172 1:99635066-99635088 CTGATAGAATAGATGTTACATGG - Intergenic
913459174 1:119065226-119065248 CTGACAAAACAGAACTTAGAAGG + Intronic
916967514 1:169965883-169965905 TTGGTAAAACTGATCTTCCAAGG + Intronic
918025644 1:180742284-180742306 CTGCTAAAACAGTGCTTACAGGG - Intronic
919549610 1:198967786-198967808 ATTATGAAACAGATATTACAAGG - Intergenic
924212158 1:241781556-241781578 CTGATAAAAAAGAAGTTCCATGG + Intronic
1063738798 10:8794389-8794411 CTGATATTACAGAAATTACAAGG - Intergenic
1064612167 10:17114879-17114901 CTGTTAAAATAAAACTTACAAGG + Intronic
1064679363 10:17794293-17794315 GTGATAAAACAAAACTTAAAAGG - Intronic
1066587787 10:36956605-36956627 CTGCTAAAAGAGATATTACTAGG - Intergenic
1067924767 10:50496999-50497021 CTGGTAAAAGTGATCTTAAAAGG + Intronic
1069531788 10:69225161-69225183 CTCAAAAAACAGGACTTACATGG + Intronic
1069830174 10:71278133-71278155 CTAATAGAACATACCTTACAGGG + Intronic
1070432168 10:76351724-76351746 CTGATAAGACCTATCTCACAGGG - Intronic
1071773210 10:88753327-88753349 TTGAGAAAACTGACCTTACAAGG + Intergenic
1072359657 10:94647291-94647313 CTGATACAACAAATCCTGCAGGG + Intergenic
1077992516 11:7424560-7424582 TTCATACAACAGATGTTACATGG - Intronic
1078367797 11:10720917-10720939 CTGATACAACAGATATCTCAAGG + Intergenic
1078893611 11:15579048-15579070 CTGATGAAACAAAGCTCACAAGG - Intergenic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1085900309 11:80691344-80691366 CCGCTAAAAGAGATCTTACTAGG + Intergenic
1086564555 11:88211320-88211342 CTTATAACACACATCTTACATGG + Intergenic
1087163719 11:94976593-94976615 CTGATAAAAATGATCTGAAAGGG - Intronic
1087948400 11:104193784-104193806 ATGATAAAACAGATCTCCCGGGG + Intergenic
1090721459 11:129477964-129477986 CTGATAAAGCAGCACTTAGAAGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092896350 12:13014587-13014609 CTGATCACACAGATATTAAAAGG - Intergenic
1094601025 12:31908998-31909020 CTGAAAAAGGAGATCTTAAATGG + Intergenic
1096913043 12:55003258-55003280 CTGAAAGAACATAGCTTACAAGG + Intergenic
1097457721 12:59820551-59820573 ATGATAAAATACATCTTTCAAGG - Intergenic
1101389127 12:104284158-104284180 CTGAGAAAACAAATATTCCAGGG + Intronic
1103102440 12:118190364-118190386 TTGAGAAAGCAGATCTTTCAAGG - Intronic
1105432203 13:20346857-20346879 CTCATAAAACAAATTTTATATGG - Intergenic
1106503538 13:30352088-30352110 TTGATAAAACAGCTCTTGCGGGG - Intergenic
1106891725 13:34253423-34253445 CTGGTTAAACAGTTATTACAGGG + Intergenic
1107178915 13:37433324-37433346 TTGATAGAATAGTTCTTACAAGG + Intergenic
1107422681 13:40263535-40263557 TTGATAAACCAGATCTTTCTAGG - Intergenic
1107446535 13:40474472-40474494 TTGTTAAAACGGATTTTACAAGG + Intergenic
1107502731 13:40997204-40997226 CTGTGAAAACAGATCATTCAGGG - Intronic
1107727727 13:43316869-43316891 ATGATAAAAGAAATCTTGCAAGG - Intronic
1109199843 13:59418160-59418182 ATAATAAAACAGATATTACCAGG - Intergenic
1110518966 13:76451542-76451564 CAGATAAAGCAGTTATTACAGGG + Intergenic
1110660349 13:78053396-78053418 CTGAAAAAACAGGCCTTACTGGG + Intergenic
1110975720 13:81831628-81831650 CTTACAAAACACATATTACAGGG + Intergenic
1110995692 13:82105898-82105920 GTGATAAAACTAAACTTACAAGG + Intergenic
1112000500 13:95205150-95205172 CCTATAAAACAGACCATACAGGG - Intronic
1112251961 13:97789978-97790000 CTGTTAAAACAGTACTTACAGGG - Intergenic
1112563157 13:100531702-100531724 CTGAGAAAGCCGATTTTACACGG - Exonic
1112715553 13:102180867-102180889 ATGATAAAACAGATCTTTTTGGG - Intronic
1113683911 13:112265505-112265527 CAGCTAAAACAGAGCTTAGAAGG - Intergenic
1114783916 14:25571874-25571896 CTGAGAAAACAGTTCCTACTAGG - Intergenic
1116028910 14:39547386-39547408 CTGATAAAAGAAATATTAGAAGG + Intergenic
1117310269 14:54514750-54514772 CTGATAAAGCAGTACTTACAAGG - Intronic
1121663367 14:95652697-95652719 CTGATAAGACAGAAATTACCAGG - Intergenic
1121983105 14:98472037-98472059 CTGAAAAATCAGATTTTCCAAGG + Intergenic
1123496044 15:20828061-20828083 CCGATAAAACAGACTTTAAATGG + Intergenic
1123552529 15:21397153-21397175 CCGATAAAACAGACTTTAAATGG + Intergenic
1123588775 15:21834541-21834563 CCGATAAAACAGACTTTAAATGG + Intergenic
1126606412 15:50481308-50481330 CTCATAAAACAGAACTTGAATGG - Intronic
1131858775 15:96628712-96628734 TTTATAAATCAGATGTTACAAGG - Intergenic
1202960878 15_KI270727v1_random:124373-124395 CCGATAAAACAGACTTTAAATGG + Intergenic
1133528459 16:6629805-6629827 CTGATTAAAAGGATCTTAAATGG - Intronic
1137813354 16:51374423-51374445 CAGAAAAAAAAGATATTACATGG + Intergenic
1138425727 16:56931162-56931184 CTGAAAAAACAGATGTCCCAAGG + Intergenic
1139059544 16:63232082-63232104 CTTATAAAAGAGATCTCAGAAGG + Intergenic
1139134396 16:64184161-64184183 CTGAGAAAAATGACCTTACAGGG + Intergenic
1140551145 16:75867238-75867260 GTGCTAAAAAAGATATTACAGGG + Intergenic
1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG + Intronic
1144189429 17:12830688-12830710 CTGGAAAAAAAGACCTTACAGGG - Intronic
1145087830 17:19957799-19957821 CTGATAACACACTTCTTAGAAGG + Intronic
1146499954 17:33355722-33355744 ATGAATAAACAGATCTTACCAGG - Intronic
1149061658 17:52429751-52429773 CTGATATAGCAGATCTTGGATGG + Intergenic
1149365163 17:55936560-55936582 CTGATTAAATAGAAGTTACAAGG + Intergenic
1150504733 17:65687045-65687067 ATGATAATACTGATCTTACATGG + Intronic
1153151427 18:2099023-2099045 TTGATAAAACAGATATTGAAAGG + Intergenic
1154453446 18:14500550-14500572 CTGATAAAACAAACTTTAAATGG + Intergenic
1157230972 18:45915723-45915745 CTGATAAGACAGAGATTTCAAGG + Intronic
1158433108 18:57409639-57409661 CAGATAAAGCAGTGCTTACAGGG + Intergenic
1159793576 18:72815007-72815029 TTGCTAAAGCAGAACTTACAGGG + Intronic
1160091267 18:75828903-75828925 GTGATAAAACAAATTTTACTTGG + Intergenic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1163219482 19:15904877-15904899 CTGAGAAAAAAGAACTTAGATGG - Intergenic
1164790729 19:30977736-30977758 CAGATAAAACAGACTTCACAAGG - Intergenic
1165321185 19:35086265-35086287 CTCATAAAACAGATGTTCTAGGG - Intergenic
1165526187 19:36356923-36356945 GTGGTAAAACATATCTGACAAGG - Intronic
1168579889 19:57546403-57546425 AAAATAAAACTGATCTTACAGGG + Intronic
1168600866 19:57717507-57717529 CTGCTAAAGCAGTACTTACAGGG + Intronic
925496797 2:4459998-4460020 TTGGTAAAACAGATATTTCATGG + Intergenic
925858397 2:8152344-8152366 CATATAAAACATATCTTACTGGG + Intergenic
926487382 2:13478682-13478704 TAGAGAAAACAGATATTACAAGG + Intergenic
926612935 2:14965024-14965046 CTGATAAAGCAGTACTTAAAAGG + Intergenic
928740554 2:34347227-34347249 CTGATAAAACAGAATCTACATGG + Intergenic
930336466 2:50053652-50053674 ATGATAAAACAGATCTTTTATGG + Intronic
930552120 2:52849006-52849028 CTGATGAAACATATCCTAAAAGG - Intergenic
931923124 2:67042612-67042634 CTGATAAAGTATATATTACATGG + Intergenic
934043707 2:88152648-88152670 CTGATAACACAGAAATTAAAAGG + Intergenic
935490078 2:103708551-103708573 CTGAAAAAAGAAATCTTAAATGG + Intergenic
936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG + Intergenic
937171807 2:119879576-119879598 CTGATTGAACAGGTCTTAGATGG + Intronic
937780830 2:125835218-125835240 CTGACAAAACAGACTTTTCATGG - Intergenic
938650528 2:133378188-133378210 ATGATAGTACAGATCTTACTAGG + Intronic
938997705 2:136698222-136698244 CTGATACAACAAATCTCCCAAGG - Intergenic
940529542 2:154863292-154863314 TTGATAAAACATATTTTCCAGGG + Intergenic
940881387 2:158950353-158950375 CTGCTAAAACAGACCTAATAGGG + Intergenic
943644484 2:190394256-190394278 TTTATAAAACATATTTTACATGG - Intergenic
945837058 2:214846236-214846258 AGGATAATACAGATCTTTCAAGG - Intergenic
945837329 2:214848597-214848619 AGGATAATACAGATCTTTCAAGG - Intergenic
946549419 2:220784535-220784557 CTGATACAACACATGTTAGATGG + Intergenic
1169907667 20:10619686-10619708 CTGAAAATACAGCACTTACAGGG + Intronic
1171313504 20:24166073-24166095 TTGCTAAAACAGATGTCACAAGG - Intergenic
1171452452 20:25245732-25245754 TTGCTAAAACAGATGTCACAGGG + Intergenic
1174637623 20:52015437-52015459 CTGATAAAAAAGATCAGTCACGG - Intergenic
1174692571 20:52522536-52522558 CTGCTAAAACGGAACTTAGAGGG - Intergenic
1176820738 21:13652755-13652777 CTGATAAAACAAACTTTAAATGG - Intergenic
1177052305 21:16251699-16251721 TTGACAAAACTGATATTACAGGG - Intergenic
1177281691 21:18989376-18989398 CTGAAACAACAAATCTGACAAGG + Intergenic
1178186939 21:30233207-30233229 AAGATAAAATAGATCTCACATGG + Intergenic
1178438686 21:32581354-32581376 CTGAAAAATCAGATCACACATGG - Intronic
1178521971 21:33294124-33294146 CTGATTTCTCAGATCTTACAGGG - Intronic
1180992084 22:19942697-19942719 CAGAAAAAACAGATTTTACTTGG + Intronic
1181451805 22:23027670-23027692 CAGGGTAAACAGATCTTACATGG - Intergenic
1185238568 22:49728431-49728453 CAGAGGAAACAGATGTTACAGGG - Intergenic
951714844 3:25629955-25629977 CTCATAAAACAAATATTAAAGGG + Intronic
951982451 3:28580640-28580662 CTGATAAACCCTATCTTACCTGG - Intergenic
954118458 3:48480461-48480483 CAGATAAAATAGTTCTTAGAGGG + Intronic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
956900629 3:73712218-73712240 CTGAAAAAACAGATATTACTGGG - Intergenic
957180529 3:76871649-76871671 CAGATAAAACATATTTTTCAGGG + Intronic
957236294 3:77596603-77596625 CGGCTAAAACAGAAATTACAAGG - Exonic
957810123 3:85211104-85211126 CTGATAACACAGAAATTAAAAGG - Intronic
958819740 3:98959442-98959464 CTGCTAATAAAGATCTTACGGGG - Intergenic
959647494 3:108720374-108720396 CTGATAAAACAGATGATTCAAGG - Intergenic
959980906 3:112516573-112516595 TGGATAAAGCAGATTTTACAAGG - Intergenic
961024620 3:123543303-123543325 CCAATAAAACACATTTTACATGG + Intronic
961643013 3:128376548-128376570 CTGACAAAACACAGCTTACCTGG - Intronic
962337587 3:134550063-134550085 TTGAAAGAACAGATTTTACAGGG + Exonic
964265516 3:154890433-154890455 ATAATAAAACAAATCTTAGAAGG - Intergenic
965052465 3:163668457-163668479 CAAATAAAAAAGATCTTTCAAGG - Intergenic
965164543 3:165179408-165179430 CTGAAAATACATATCTTTCATGG - Intergenic
966838386 3:184067675-184067697 CAGCTAAAACAGATGTTCCAGGG + Intergenic
967236738 3:187392391-187392413 CTTAGAAAACAAAACTTACATGG + Intergenic
970557545 4:17249771-17249793 CTAAAAAAACAGATCTTTCTAGG - Intergenic
971431146 4:26569088-26569110 ATGATAATACAGATTTTACTGGG - Intergenic
971510046 4:27413536-27413558 CTGATAAAACTGAGCCTGCATGG + Intergenic
971666789 4:29497310-29497332 CTGATAAGAAAGGTATTACATGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
975888309 4:78992594-78992616 GTGATAAATCAGAACTTAAAAGG + Intergenic
976419686 4:84826924-84826946 CAGATTAACCAGATCTTTCAAGG + Exonic
976648776 4:87413045-87413067 CTGTGAAGACAGATGTTACATGG + Intergenic
976770664 4:88649058-88649080 CTGAAAAAACAGATCATGCAGGG - Intronic
977180822 4:93871423-93871445 CTGGCAAAACAGATCTGACGGGG + Intergenic
977249630 4:94675502-94675524 CTGGTACAACAGATCCTGCATGG + Intergenic
977708675 4:100099662-100099684 CTCATTAAACAAATCTTAGAGGG + Intergenic
978389062 4:108205395-108205417 CTGAAAAGAGAGATTTTACAAGG - Intergenic
978750472 4:112240646-112240668 CAGATAAAAGAGATGTTTCAGGG - Intronic
979374682 4:119932312-119932334 CTGATAAATCAGAACTTTTAGGG + Intergenic
979594685 4:122521490-122521512 CTGATAATGCAGATTTTAAAAGG - Intergenic
979950294 4:126884538-126884560 CTGATAAAACATGTATTCCAAGG + Intergenic
980552087 4:134351700-134351722 CTGATAACACAGAAGTTAGAAGG + Intergenic
980901033 4:138905425-138905447 CTGATAGAACAAAACTTTCATGG + Intergenic
981875320 4:149536050-149536072 ATGATAAGACAAATCTTTCAGGG + Intergenic
982983755 4:162177355-162177377 ATTATAAAACTGATATTACATGG + Intergenic
983550650 4:169014065-169014087 ATGATAAATCAGATGTTACCAGG - Intergenic
984131724 4:175884101-175884123 CTGATAAAACATACGTCACAGGG + Intronic
984663629 4:182401573-182401595 TTGATAAAACAGATGTTGAATGG - Intronic
985191419 4:187377890-187377912 CAGAAAAAGCAGAGCTTACAGGG + Intergenic
985359520 4:189157098-189157120 CTGATAAAACAGTGCTTAGAGGG - Intergenic
986378549 5:7159978-7160000 CAGATAAAACAGTGTTTACAGGG - Intergenic
987877720 5:23700755-23700777 CTGGTAAAACATATTTTACAAGG + Intergenic
987926005 5:24342732-24342754 CTTATTACACAGATCATACACGG + Intergenic
988083440 5:26442329-26442351 CAGATAAAACACACCTTGCAGGG + Intergenic
989541903 5:42627893-42627915 TAGAAAAAACAGATCATACAGGG + Intronic
994004920 5:94826728-94826750 CTGATAAAACAGACTTTAAGTGG - Intronic
994575410 5:101572383-101572405 CAGATAAAACAAATGTCACATGG - Intergenic
996587987 5:125112216-125112238 AAGATAAAACAGGTCTCACATGG - Intergenic
997077527 5:130698048-130698070 CTGATAAATCTGATTTTGCATGG - Intergenic
997242623 5:132318953-132318975 CTGATTACACAGATCTTTTATGG - Intronic
998221243 5:140282317-140282339 CTGAAAAAACAAAACTTATAGGG - Intronic
998599639 5:143572196-143572218 CTCATAAAATAAATCTTGCAAGG - Intergenic
998946489 5:147345244-147345266 CTTACAAAAGAAATCTTACAGGG + Intronic
1000445311 5:161311903-161311925 TTTATAAAACAGGTGTTACAGGG + Intronic
1000703338 5:164480098-164480120 CTGCTAAAACACATCTTGCTAGG - Intergenic
1001808754 5:174610795-174610817 CTGCTAAATCAGATCTTCCGGGG + Intergenic
1002449681 5:179311538-179311560 TTGATAAACTGGATCTTACAAGG - Intronic
1003236010 6:4295623-4295645 CTGATGAATCAGATCCTACAGGG + Intergenic
1003856597 6:10282283-10282305 ATAATAAATCAGATCATACAGGG - Intergenic
1004174408 6:13327138-13327160 CTGATAAAATAGATGGCACAAGG + Intronic
1004541669 6:16556229-16556251 CTGATAAACCAAATATTACTAGG - Intronic
1005224422 6:23624712-23624734 CAGATAATACAAATATTACAAGG - Intergenic
1006268197 6:32943079-32943101 CTGAAAAAGCAGATTTTAAACGG + Intronic
1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG + Intergenic
1006999444 6:38295742-38295764 CTCAGAATACAGATCTTAAATGG - Intronic
1007296104 6:40822090-40822112 CAGATTAAGCAGATCTTACACGG - Intergenic
1009347173 6:62628033-62628055 CTGTGAAAACTGACCTTACAGGG + Intergenic
1010799513 6:80158753-80158775 CAGATAAAACAGACCCTAAAGGG + Intronic
1011430222 6:87278130-87278152 GTGATAATACATATCTCACAGGG - Intergenic
1012262568 6:97104684-97104706 CTTGTAAGACAGATCTTTCAAGG - Intronic
1014542807 6:122697302-122697324 CTGATAAAACAGGTCTCTAATGG - Intronic
1015550988 6:134412289-134412311 CTGTTAAAACACATATTACTGGG + Intergenic
1015674003 6:135724506-135724528 CTGAGAAAATAGATGTTAAAGGG - Intergenic
1016236942 6:141879215-141879237 CTGAAAACATAGATATTACAAGG - Intergenic
1016790932 6:148065874-148065896 CTTCTAAAACAGATTTTAAAAGG - Intergenic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1022889278 7:34679217-34679239 CTGATATGTAAGATCTTACAAGG - Intronic
1023384059 7:39637322-39637344 CTGATAATAAAGATCAAACAAGG - Intronic
1026438726 7:70423957-70423979 GTGATATAACATATCTTTCATGG + Intronic
1026667230 7:72352633-72352655 CAGCTAAAACAGTGCTTACAAGG + Intronic
1027339982 7:77196636-77196658 CACATAAAACTGATCATACAAGG + Exonic
1030710983 7:112748710-112748732 CTGCTAAACCAGAGCTGACAGGG + Intergenic
1030825351 7:114149401-114149423 CTAATAAAAAAGCTGTTACATGG + Intronic
1033021272 7:137726954-137726976 CAGATAAAATAGTTCTTATATGG + Intronic
1036715971 8:11124458-11124480 CTGAAAAAACAATTATTACATGG + Intronic
1039219349 8:35311309-35311331 CTGAAAAAAAACATCTTCCATGG - Intronic
1040947027 8:52894718-52894740 CTGGTAAATCAGCCCTTACAGGG + Intergenic
1041017004 8:53600942-53600964 TTGCTAATACAGATCTTAAAGGG - Intergenic
1041202750 8:55466718-55466740 CTGATACATCATATATTACATGG - Intronic
1043789277 8:84443190-84443212 CTGATAAAGCTAATATTACATGG + Intronic
1044023891 8:87143905-87143927 CTGATAAAACAACTGTTAAAGGG + Intronic
1044834616 8:96283521-96283543 CTGACAAAACACCTCTGACATGG - Intronic
1047408715 8:124606704-124606726 CTGATAAAACAGATGTTCGGGGG - Intronic
1049382095 8:142321334-142321356 CAGCTAAAACAGTACTTACAAGG + Intronic
1051093585 9:13438680-13438702 CTGATTAAACAGTTCTTCCTTGG - Intergenic
1052108455 9:24548908-24548930 CTGAGAAATCAGATCTACCATGG - Intergenic
1052195859 9:25713951-25713973 CTGATAAAACAGACATTCCTTGG + Intergenic
1053048361 9:34938197-34938219 CTTATAAAACAGAACTTTCAAGG + Intergenic
1053378281 9:37626863-37626885 CTGCTAAAAAAGATATTTCATGG - Intronic
1055666161 9:78555203-78555225 CTGATAAAAGAGATATAAGAAGG + Intergenic
1055803662 9:80068868-80068890 GTGATAAAACAGATGTTAGCAGG + Intergenic
1056583490 9:87913010-87913032 CTGATAAACCATATCTGACAAGG + Intergenic
1056583984 9:87916481-87916503 CTGATAAACCATATCTGACAAGG + Intergenic
1056612885 9:88136445-88136467 CTGATAAACCATATCTGACAAGG - Intergenic
1056613385 9:88139935-88139957 CTGATAAACCGTATCTGACAAGG - Intergenic
1057330463 9:94109768-94109790 CTGAAAAAAGAGATATGACAAGG + Exonic
1058132592 9:101269687-101269709 TTTATAGAACAGATGTTACAAGG + Intronic
1058975835 9:110124815-110124837 CACTTAAAACATATCTTACAAGG + Intronic
1060356954 9:122917882-122917904 CTTATACAACAGCACTTACATGG - Exonic
1203526618 Un_GL000213v1:96810-96832 CTGATAAAACAAACTTTAAATGG + Intergenic
1189654919 X:43234958-43234980 CAGGGAAAACAGATCTTTCACGG + Intergenic
1189958343 X:46300068-46300090 CTGATAAAATAGTCCTTAGAGGG + Intergenic
1191685317 X:63883909-63883931 CTGATTAAAAATATATTACACGG + Intergenic
1192098504 X:68238991-68239013 CGGAAAAATCAGATCATACATGG + Intronic
1193630899 X:83887080-83887102 TTGCTAAAACGGATTTTACAAGG - Intergenic
1194487286 X:94500554-94500576 CTGATAAAAAAAATATTTCAAGG + Intergenic
1194655334 X:96566276-96566298 CTAATAAAAAAGTTCTTAGAAGG + Intergenic