ID: 1085784220

View in Genome Browser
Species Human (GRCh38)
Location 11:79437449-79437471
Sequence CGGCGCTTGCGGCTGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085784215_1085784220 -6 Left 1085784215 11:79437432-79437454 CCCTGCACTGTGCCGCGCGGCGC 0: 1
1: 0
2: 0
3: 11
4: 60
Right 1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1085784213_1085784220 0 Left 1085784213 11:79437426-79437448 CCGGGACCCTGCACTGTGCCGCG 0: 1
1: 0
2: 2
3: 12
4: 187
Right 1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1085784216_1085784220 -7 Left 1085784216 11:79437433-79437455 CCTGCACTGTGCCGCGCGGCGCT 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1085784207_1085784220 28 Left 1085784207 11:79437398-79437420 CCGGGCCGGGGACGGGAGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1085784209_1085784220 23 Left 1085784209 11:79437403-79437425 CCGGGGACGGGAGAAAGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085784220 Original CRISPR CGGCGCTTGCGGCTGGAACT TGG Intronic
905412695 1:37782662-37782684 CGGCGGTTGGTGCTGGAGCTGGG - Intergenic
906118006 1:43368140-43368162 CGGCGCTTCCTGCTGGGACCCGG - Intergenic
911527585 1:99004908-99004930 CGGCGCTTGCGGCGGGCAGGGGG - Intronic
914911414 1:151790448-151790470 CGGCGCTGGTGGCTGCAGCTGGG - Intronic
1068900946 10:62268713-62268735 CGGCCCCTGCGACTGGGACTTGG - Intergenic
1073115646 10:101090038-101090060 AGGCGCTGGAGGCTGGAACTAGG + Exonic
1073287905 10:102399459-102399481 CGGGGCCTGCGGCTCGCACTGGG - Exonic
1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG + Intronic
1087156814 11:94912988-94913010 CAGCGCCTGGGCCTGGAACTGGG + Intergenic
1094316161 12:29139153-29139175 CGACGCTTGGGGTTGGGACTGGG + Intergenic
1097649615 12:62280784-62280806 AGGCTCTTGCAGCTGGATCTGGG + Intronic
1116952817 14:50894781-50894803 CGACGCTTGGGGTTGGGACTGGG - Intronic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1132398218 15:101489533-101489555 CGGCGCGAGCGGCCGGAACCCGG + Exonic
1132724990 16:1334562-1334584 GGGCGCCAGCGGCTGGACCTTGG + Exonic
1141771013 16:86089657-86089679 AGACGCTGGCAGCTGGAACTGGG + Intergenic
1143456648 17:7072102-7072124 CTGCAGTTGGGGCTGGAACTGGG + Intergenic
1148213147 17:45820128-45820150 TGGCCCTTGGGGCTGGAACAGGG - Intronic
1151858292 17:76738029-76738051 CGGCTGCTGCGGCTGGCACTTGG + Exonic
1157610247 18:48951182-48951204 GGGGGCGTCCGGCTGGAACTGGG + Intergenic
1160844054 19:1158958-1158980 CGGCGGTTGCAGCTGCAAGTGGG - Intronic
1163517437 19:17773652-17773674 CAGCATTTGTGGCTGGAACTTGG - Intronic
1164990074 19:32676565-32676587 CGGCGCGTGCAGCGGGAACGCGG - Exonic
937954774 2:127416048-127416070 CGGCGCCCCCGGCTGGAACCAGG + Intergenic
946399739 2:219461995-219462017 CGGCGGTTCTGGCTGGGACTGGG - Exonic
948458302 2:238117373-238117395 CTGGGCTTGTGGCTGGAACTTGG + Intronic
1174416375 20:50369838-50369860 CAGCTGTTGAGGCTGGAACTTGG - Intergenic
1182998497 22:34835901-34835923 CGACGCTTGGGGTTGGGACTGGG - Intergenic
952343659 3:32465532-32465554 CGACGCTTGGGGTTGGGACTGGG + Intronic
963503941 3:146161397-146161419 CAGCGCTTCTGGCTGGAACGGGG + Intronic
968693779 4:2010070-2010092 TGGCCCTGGCGGCTTGAACTTGG + Exonic
978093561 4:104747331-104747353 CTGGTCTTGTGGCTGGAACTGGG - Intergenic
993364624 5:87020363-87020385 CAGCCATTGCAGCTGGAACTGGG - Intergenic
995462664 5:112419695-112419717 CGGCGCTTGCGGCTGGGGGACGG - Intergenic
1004836900 6:19540485-19540507 CGACGCTTGGGGTTGGGACTGGG - Intergenic
1013170571 6:107634180-107634202 CGGTGCATGGGGCTGGAAGTGGG - Exonic
1013643639 6:112113327-112113349 CAGCTTTTGCAGCTGGAACTTGG - Intronic
1026115937 7:67495723-67495745 AGGCGCTTGGGTCTGGGACTAGG + Intergenic
1035187782 7:157139386-157139408 CGGGGCTCGGGGCTGGGACTCGG + Intronic
1035555427 8:564055-564077 CGGAGCTGGCGGCTGGAGCCTGG - Intergenic
1043353773 8:79390208-79390230 CGACGCTTGGGGTTGGGACTGGG + Intergenic
1048345720 8:133572706-133572728 CGGAGGCTGCGGCTGGAGCTTGG + Intergenic
1049376161 8:142290145-142290167 CGGGGCTTCTGCCTGGAACTAGG - Intronic
1058021918 9:100098868-100098890 AGGCGCTGGCGGCTGGGACTGGG + Exonic
1059434377 9:114267334-114267356 TGGAGCTTGGAGCTGGAACTAGG - Intronic
1062504865 9:136868061-136868083 CGGAGCTTGGTGCTGGAAGTCGG - Intronic
1185612461 X:1401043-1401065 CGGAGCTTGCGCCTTGAAATAGG + Intergenic