ID: 1085784405

View in Genome Browser
Species Human (GRCh38)
Location 11:79438147-79438169
Sequence CTTCCCCCCAGCCCGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085784405_1085784413 21 Left 1085784405 11:79438147-79438169 CCTGACTGCGGGCTGGGGGGAAG 0: 1
1: 0
2: 6
3: 22
4: 280
Right 1085784413 11:79438191-79438213 CCAGACTTCAGCGTTCCCCACGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085784405 Original CRISPR CTTCCCCCCAGCCCGCAGTC AGG (reversed) Intronic
901168384 1:7236052-7236074 CTCCCCCACACCCCGCAGCCCGG - Intronic
902736312 1:18403611-18403633 CTTCCCCCCAGGCCACACTGGGG - Intergenic
904335407 1:29794066-29794088 CTTCCCCCCAGGCCCCATGCCGG - Intergenic
904591427 1:31617648-31617670 CCTCCCCGCAGCGCGCAGCCCGG + Intergenic
907629719 1:56068299-56068321 CTTCCCACCCCCCAGCAGTCAGG + Intergenic
909958337 1:81803354-81803376 CTCACCCCCACCCCGCAGTCTGG - Intronic
910657527 1:89633435-89633457 CTTCCCCCCGGCTCTCAGACAGG + Intronic
912650193 1:111431470-111431492 CTTGCCCCCAACCCGCCGACAGG - Intergenic
912711626 1:111954008-111954030 CTTCCCCCCACCCCCCATCCTGG - Intronic
913592354 1:120341510-120341532 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
913651005 1:120913635-120913657 CCTCCCCCCACCCCCAAGTCTGG + Intergenic
914170109 1:145215432-145215454 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
914525226 1:148459395-148459417 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
914598450 1:149176435-149176457 CCTCCCCCCACCCCCAAGTCTGG + Intergenic
915034343 1:152909827-152909849 CCTCTCCCCTGCCCTCAGTCAGG + Exonic
915334045 1:155130300-155130322 CTTCCCCCGACCCCGCAAGCTGG - Intronic
915571472 1:156747313-156747335 CCACCCCCAAGCCTGCAGTCTGG + Intronic
917728247 1:177848086-177848108 GTTCCCCACAGGCCCCAGTCAGG - Intergenic
917978608 1:180255780-180255802 CTTCACCCCAGGCCCCACTCGGG - Intronic
919134019 1:193486481-193486503 CTTCCCCCCCTCCCTCAGTTTGG + Intergenic
920179837 1:204125847-204125869 CTGCCCCACAGCCCGCAGGCTGG + Exonic
921219596 1:212963696-212963718 CTTCTCCCCAGCCCACTTTCAGG + Intronic
921351931 1:214244753-214244775 CTGCCCTCCTGCCCACAGTCTGG + Intergenic
1063203413 10:3807553-3807575 CTGCATCCCAGCCCGCAGTGCGG + Intergenic
1065431378 10:25660865-25660887 GTTCCCCCCAGGCCTCAGGCAGG + Intergenic
1067175114 10:43940273-43940295 CTTGCCCAGAGCCGGCAGTCAGG + Intergenic
1067451814 10:46386401-46386423 CTTCCCCACAGCAGGAAGTCAGG + Intronic
1067585424 10:47473354-47473376 CTTCCCCACAGCAGGAAGTCAGG - Intronic
1069849918 10:71397772-71397794 CCTCTGCCCAGCCCGCAGTAGGG - Intronic
1070337102 10:75465725-75465747 CTTCCCCCCTTCCCCCAATCTGG + Intronic
1070387575 10:75939739-75939761 GTTCACCCCAGCCCAAAGTCCGG - Intronic
1070709892 10:78673307-78673329 CTTCGTCCCAGCCGTCAGTCAGG - Intergenic
1072783245 10:98264403-98264425 CTTACCCCCAGACCACAGTGTGG + Intronic
1073420774 10:103421923-103421945 CGTCACTGCAGCCCGCAGTCCGG + Intronic
1074678812 10:115882323-115882345 CTTCCCAGCAGCCCTCAGTGGGG - Intronic
1075124262 10:119687114-119687136 CCTTCCCCCACCCCACAGTCTGG - Intergenic
1075784532 10:125039974-125039996 CTCTTCCCCAGGCCGCAGTCAGG - Intronic
1076574313 10:131453729-131453751 CTTCCCTCCACCCGGGAGTCCGG - Intergenic
1076725702 10:132412079-132412101 CTTCCTCCCAGCCAGCAGCTTGG + Intronic
1076945591 10:133646983-133647005 CTGCCCCCCAGCCCGCAGTGGGG - Intergenic
1077211111 11:1371329-1371351 CTTCCCCCCCGCCCGCCCCCCGG - Intergenic
1078102145 11:8336280-8336302 CTAACCCCCAGCCCACAGCCTGG - Intergenic
1081153692 11:39663681-39663703 CTTCCTCCCAGCCCAAAGGCGGG - Intergenic
1081450488 11:43166931-43166953 CTTCCCCCCAGTCCACATCCCGG - Intergenic
1083617148 11:64031944-64031966 CTTCCCCACAGGCCCCAGCCTGG - Intronic
1083744419 11:64727243-64727265 CTCCCCCCCAGCCCTCAGTGGGG + Intronic
1083941814 11:65900114-65900136 CCTCGCCCCAGCCCCCAGCCCGG + Intronic
1084190232 11:67495336-67495358 CTTTCCCCCAGCACACAGCCTGG - Intronic
1084336460 11:68460699-68460721 GTTCCCCCCCGCCCGCCCTCTGG - Intergenic
1084857433 11:71998024-71998046 TTTCCCCCCACCCCCCTGTCAGG + Intergenic
1084891155 11:72237745-72237767 CTTCCCTCCACCCCGCATCCGGG + Exonic
1085064445 11:73481058-73481080 CTTCCCTCTATCCCTCAGTCTGG + Intronic
1085232950 11:74988793-74988815 CCTCCCTCCAGCCCGCAGCTCGG - Exonic
1085784405 11:79438147-79438169 CTTCCCCCCAGCCCGCAGTCAGG - Intronic
1085784604 11:79439121-79439143 CTTCCCCCCACCCCCCACCCCGG + Intronic
1085786535 11:79456584-79456606 CTTCCCTCCAGCCCTCAGCAGGG + Intergenic
1086307981 11:85502643-85502665 CTTGCCCCCAACCCGCCGACAGG - Intronic
1089561192 11:119344041-119344063 CATCCCCCCAGCCAGCAGTGGGG - Intronic
1091222037 11:133935536-133935558 CTACCCTCCAGCCTACAGTCTGG + Intronic
1091391849 12:130712-130734 CCTCCTCCCAGCCTGCTGTCTGG - Intronic
1091821549 12:3479248-3479270 CTTCCCCCCAGCTCTCACTTGGG + Intronic
1091825905 12:3512518-3512540 CTTCACCCCAGCCAGAAGTCAGG + Intronic
1092774317 12:11929216-11929238 CTTCATCCCAGCCCACAGGCAGG + Intergenic
1096105460 12:48994918-48994940 CCTCCCCCCACCCCCCATTCCGG - Intergenic
1096231857 12:49901166-49901188 CTTCCCCCCAGCCCCCACAGCGG - Exonic
1096943785 12:55381152-55381174 GTTCCGCCCAGCCCACAGGCAGG + Intergenic
1101245771 12:102883319-102883341 CTTCCCCACAGACCTCAGTCAGG + Intronic
1101821304 12:108186108-108186130 CTTCCCCAGAGCCCACAGTTTGG + Intronic
1102992757 12:117326900-117326922 CTCTCCCCCAGCCGACAGTCTGG - Intronic
1104558276 12:129821755-129821777 TTTTCCCCCAGCCCACAGACGGG - Intronic
1105565384 13:21541306-21541328 CTTCCCTCCAGCTAGAAGTCTGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107340997 13:39405624-39405646 CTTGTCCCCTGCCCCCAGTCTGG - Intronic
1110660622 13:78056140-78056162 CCTCCCACCAGCTCTCAGTCAGG - Intergenic
1111614142 13:90642703-90642725 CTTCCACCCAGTGCGCATTCAGG + Intergenic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1112556378 13:100472352-100472374 CTACTCCCCAGTCTGCAGTCTGG + Intronic
1112796074 13:103058005-103058027 CCCCTCCCCAGCCCTCAGTCTGG - Intronic
1113857095 13:113453180-113453202 GTTCCCTCCAGCCCGCACACCGG + Intronic
1117623568 14:57612384-57612406 CTTCTCCCCACCCAGCAGTTGGG + Intronic
1121315751 14:92960166-92960188 CTACTCCCCAGCCGGCTGTCTGG - Intronic
1121701024 14:95954284-95954306 CTTCCCTCCAGCCTACACTCTGG + Intergenic
1122542342 14:102505438-102505460 CCTCACTCCAGCCTGCAGTCTGG + Exonic
1122818687 14:104328786-104328808 CTTCCCACCTGCCTGCAGCCAGG - Intergenic
1122867393 14:104613414-104613436 CTTCCTGCCAGCTCCCAGTCAGG + Intergenic
1122905185 14:104798301-104798323 CTTGCTCCCAGCCTGCAGTGGGG + Intergenic
1122914859 14:104854214-104854236 CTGCCCCAGAGCCGGCAGTCAGG + Intergenic
1122978927 14:105182385-105182407 CTTCGCCCCCGCCCTCAGTTGGG + Intergenic
1202919617 14_KI270723v1_random:18787-18809 CTGCCCCCCAGCCCGCAGTGGGG - Intergenic
1124099278 15:26678400-26678422 CTTCCCCGCACTCTGCAGTCAGG - Intronic
1124291733 15:28457540-28457562 CTTCCCCCCGGCCCCCGGCCTGG + Intergenic
1125342030 15:38684692-38684714 CTTGCCCAGAGCCAGCAGTCAGG - Intergenic
1126114632 15:45197664-45197686 CATCTCCCCAGCCTGGAGTCAGG + Intronic
1126994817 15:54428942-54428964 CTTCCCCCCAGCCCCCAATCGGG + Intronic
1129178931 15:73859395-73859417 CTTCCCACCTGCCAGCAGCCTGG + Intergenic
1129360585 15:75021538-75021560 CTGCCCCACAGCCCGCTGTGAGG - Intergenic
1129361778 15:75028979-75029001 CCTCACCCCAGCACACAGTCGGG - Intronic
1129521810 15:76190954-76190976 CTTCCCGCGAGCCCGCGGCCGGG + Intronic
1130104661 15:80920315-80920337 CTTCCCCCCAGCACACAGAGAGG - Intronic
1131058311 15:89389640-89389662 CTTCCCCCCAGCTCCAAGCCAGG + Intergenic
1131160532 15:90102172-90102194 CGTCCCGCCAGCCCGCAGCCCGG - Intronic
1131423539 15:92326847-92326869 CTGCCCCTCAGCCCTCAGGCAGG - Intergenic
1131446578 15:92503094-92503116 CTTCCCCCCATCCCACAGAGTGG + Intergenic
1131766440 15:95680956-95680978 CTTCCCCCCACCTCTCTGTCTGG + Intergenic
1132589775 16:721542-721564 CTCCCGCCCCGCCCGCAGCCCGG - Intronic
1132945948 16:2531572-2531594 CTGCCCCTCACCCCGCAGTCAGG - Intergenic
1133282997 16:4677586-4677608 CTCCCGCCCATCCCGCAGGCAGG - Intronic
1133650235 16:7805863-7805885 CTTCACCCCAGCCCTCCTTCAGG - Intergenic
1133767662 16:8849093-8849115 CTGCCTCCCAGCCCACAGCCAGG + Exonic
1134844155 16:17425714-17425736 CTTTCCCCCAGCACACAGCCAGG + Intronic
1135861365 16:26058943-26058965 CTTCCTCCCAGCCCCCAGGTTGG - Intronic
1136115342 16:28091043-28091065 CTTCCGCTCAGCCCGCAGCCAGG + Intergenic
1136428864 16:30185802-30185824 CTGTCCCCCAGCTCGCAGGCAGG + Intronic
1137788020 16:51152707-51152729 CCTCCCCCCACCCCGCTTTCCGG - Intergenic
1137972536 16:53000491-53000513 CTTCCCTCCTGTCCCCAGTCTGG - Intergenic
1138029738 16:53550848-53550870 CTTCCTCCCTGCCCTCATTCTGG + Intergenic
1138430132 16:56963186-56963208 CTTGCCCCCAGCCCACAGGGAGG + Intronic
1139974144 16:70795642-70795664 CTCCCCCACAGCCAGCAGGCAGG + Intronic
1142203099 16:88770400-88770422 CGTCCCCCCACCCCACAGACAGG - Intronic
1142924194 17:3218762-3218784 CTTGCCCCCAACCCGCTGACAGG - Intergenic
1143167093 17:4902182-4902204 CTTCCCTCCAGCCTGGCGTCTGG + Exonic
1143465543 17:7133991-7134013 GTTTCCCCCGGCCCGGAGTCGGG + Intergenic
1143492854 17:7294248-7294270 CGCCCCCCCGGCCCGGAGTCAGG - Exonic
1143688311 17:8537951-8537973 CCTGCCACCAGCCCACAGTCTGG + Intronic
1143722965 17:8826620-8826642 CTTGCCCCCAACCCCCAGACAGG - Intronic
1144759763 17:17700684-17700706 CGTCCGCCGAGGCCGCAGTCCGG + Intronic
1144798800 17:17911413-17911435 CTTCCCACCAGCCAGCCCTCTGG - Intronic
1145012728 17:19378822-19378844 CTGCTCCCCAGCCCGCAGAGGGG + Intronic
1146075612 17:29725741-29725763 CTTGCCCCCAGCCCTCCGACAGG - Intronic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1146619956 17:34389476-34389498 CTTACCCCCACCCCTCAGCCAGG - Intergenic
1147740401 17:42668085-42668107 CTTCCCTCCTGCCTGCAGCCTGG - Exonic
1148142545 17:45338725-45338747 CTTCCTCCCAGCCCCTGGTCTGG - Intergenic
1148143429 17:45344395-45344417 CTGCCCTCCAGCCTGAAGTCTGG + Intergenic
1148741805 17:49897358-49897380 CTTCTCCCCAGCCCTCAGGCAGG + Intergenic
1150423068 17:65056177-65056199 CTTCCCGCCAGCCCGCCCGCCGG + Intronic
1151584600 17:75001497-75001519 CCGCCCCCCAGCCCTCAGCCGGG - Intronic
1151770189 17:76155583-76155605 CTTCCCCCCAGCCTGCCAGCAGG - Exonic
1152017000 17:77757268-77757290 CTTCCCTACAGCCTGCAGTTGGG - Intergenic
1152302123 17:79501242-79501264 CTTCCCCGCAGCCTGCAAGCAGG - Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152507743 17:80762358-80762380 CCTCACCCCAGCCCCCAGTGGGG - Intronic
1203164885 17_GL000205v2_random:84714-84736 CTGCCCCCCAGCCAGCAGTGGGG - Intergenic
1155074650 18:22343820-22343842 CTTCCTCCCAGCATGCAGTGAGG + Intergenic
1155332399 18:24731556-24731578 CTTCCCCACCACCCACAGTCTGG + Intergenic
1155955321 18:31951916-31951938 CTTCCCCCCCTCCCCCAGACGGG - Intronic
1157278942 18:46333572-46333594 CTTCCCTTGTGCCCGCAGTCAGG + Intronic
1160567029 18:79792613-79792635 CTTCCCCTCAGCACGCAGAGAGG + Intergenic
1160682390 19:417813-417835 CCTCCACCCAGCCCCCAGCCAGG - Intronic
1160766294 19:809862-809884 CTGCCGCCCAGCCTGGAGTCTGG - Intronic
1161388365 19:4008488-4008510 CTTCCCCCAAGCGCCCACTCCGG - Intronic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1166345296 19:42161830-42161852 CTTCCCCCCAGCCCCCGCCCTGG + Intronic
1167076669 19:47254342-47254364 TTTCCTCCCAGCACGCAGCCTGG + Intergenic
1167486646 19:49766935-49766957 CCTCCCCTCCGCCCGCGGTCCGG - Intergenic
1167631825 19:50630258-50630280 TTTCCCCCCATCCCCCAGCCAGG + Intronic
1168316008 19:55485096-55485118 GTTCCTCCCAGCCCGCCCTCCGG + Exonic
925273991 2:2636185-2636207 CTTGCCCCCACCCTTCAGTCGGG + Intergenic
926749373 2:16186246-16186268 CTTCCCTACAGCCCCCAGCCAGG - Intergenic
926938652 2:18112883-18112905 CTTCCCCCCAGCACTCAGGTTGG - Intronic
929576871 2:43057510-43057532 CTTCCCTCCACCCAGCAGCCTGG + Intergenic
934566774 2:95345922-95345944 CTTCCCCGCCGCCCGAAGGCGGG + Intronic
938074645 2:128325240-128325262 CTAGCCCCCAGCCCCCAGCCCGG + Intergenic
938802178 2:134773659-134773681 CTTCCCCCCACTCCGCAGTTGGG + Intergenic
941615357 2:167712463-167712485 CTTCCCCCCAGGCTGCCATCTGG - Intergenic
942304591 2:174593779-174593801 CTTCCCCCCAGCATGTGGTCTGG + Intronic
942366715 2:175235858-175235880 CTTGCCCCCAACCCGCTGACAGG - Intergenic
943066351 2:183090781-183090803 CCCCCTCCCAGCCCGCTGTCTGG - Intronic
943483679 2:188454259-188454281 GTTCCCCCAATCCTGCAGTCTGG + Intronic
948333706 2:237191891-237191913 CTTCCCCGCATCCCACAGGCTGG - Intergenic
948426083 2:237887216-237887238 CTTCACTCCAGCCCCCAGGCTGG + Intronic
948473849 2:238203812-238203834 CGTCCGCCCGGCTCGCAGTCGGG - Intergenic
1168885719 20:1252804-1252826 CTTCCCCCCTGCCAGCACTTAGG + Intronic
1171783581 20:29443078-29443100 CTGCCCCCCAGCCCGCAGTGGGG - Intergenic
1171961549 20:31498338-31498360 CATTCCTCCAGCCCTCAGTCAGG + Intergenic
1172095229 20:32457158-32457180 CCTCCCCCGCGCCCGCAGGCTGG - Intronic
1172106795 20:32521918-32521940 CCTCGCCGCAGCCCGCAGCCGGG + Intronic
1175303301 20:57958387-57958409 CTTCCCCTCAACCAGCAGTTTGG + Intergenic
1175769066 20:61611490-61611512 CTTGCCCACATCCCGCAGGCTGG - Intronic
1176195318 20:63834194-63834216 CTGCCTCCCAGCCGGCTGTCAGG - Intergenic
1176240373 20:64073106-64073128 CTTCTCCCCAGCCCTGAGTCTGG + Intergenic
1176336743 21:5606101-5606123 CTGCCCCCCAGCGAGCAGTGGGG + Intergenic
1176391014 21:6214847-6214869 CTGCCCCCCAGCGAGCAGTGGGG - Intergenic
1176406864 21:6374373-6374395 CTGCCCCCCAGCCAGCAGTGGGG + Intergenic
1176470405 21:7101327-7101349 CTGCCCCCCAGCGAGCAGTGGGG + Intergenic
1176493966 21:7483105-7483127 CTGCCCCCCAGCGAGCAGTGGGG + Intergenic
1176506676 21:7655278-7655300 CTGCCCCCCAGCGAGCAGTGGGG - Intergenic
1177705494 21:24698926-24698948 CTTGCCCCCAACCCCCAGACAGG + Intergenic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1180301570 22:11040610-11040632 CTTTCCCCCAACCCCCAGACAGG - Intergenic
1180980849 22:19877348-19877370 CTGACCCCCAGCCAGCAGCCAGG + Intronic
1181039859 22:20186974-20186996 CTTGCCCCCAGCCCACACACCGG - Intergenic
1182049985 22:27305280-27305302 CTTCCCCCCAGCCCTGACTCCGG + Intergenic
1182444696 22:30383257-30383279 CTTGACCCCAGCCTGCAGCCTGG + Intronic
1182753257 22:32658324-32658346 CTTCCCCCAACCCCGCTTTCGGG + Intronic
1182905283 22:33930780-33930802 CTTCCTCCCACCCCCCACTCCGG + Intergenic
1183282083 22:36937501-36937523 CAGCCCCCCAGCCCCCAGCCAGG + Exonic
1185049160 22:48544728-48544750 CCTCCCCGCAGCCCGGAGTGGGG - Exonic
1185089727 22:48759051-48759073 CTTCCCTCCAGGCCACAGGCGGG + Intronic
950580467 3:13858598-13858620 CTTCCCCACAGCCCAGAGTGAGG + Intronic
950698146 3:14720428-14720450 CTTCCTCACACCCTGCAGTCTGG - Intronic
951628517 3:24693271-24693293 CTTACCCCCACCCCCCAGACAGG + Intergenic
952335401 3:32399433-32399455 ACTCCCCCCAGCACCCAGTCTGG - Intronic
952342895 3:32460079-32460101 CATCCCAGCAGCCCGCAGTGGGG - Intronic
952820732 3:37483620-37483642 CTTCCCCTCAGCCCTCAGGCAGG - Intronic
955412818 3:58666958-58666980 CTTCTCCCCAGGCCCCAGCCAGG - Intergenic
955800960 3:62685885-62685907 CTAACCCCCAGGCCACAGTCAGG - Intronic
957081891 3:75643484-75643506 CTGCCCCCCAGCCCGCAGTGGGG + Intergenic
957159036 3:76584583-76584605 CTTCCCCACAGCCCTCAGAAGGG + Intronic
959082443 3:101816419-101816441 CTTCCCCCCAACCCCCCGACAGG + Intronic
960810203 3:121620941-121620963 TGTCCTCCCAGCCCGCACTCTGG + Intronic
961222678 3:125212627-125212649 CCTCTCCCCGGCCCGCAGTTAGG - Intronic
961628374 3:128279194-128279216 CTGCACCCCTGCCCGCAGTAAGG - Intronic
963606725 3:147419147-147419169 CCTCCCGCCACCCCGCAGCCTGG + Intronic
965714820 3:171591602-171591624 CCTCCCCCCATCCCCCAGCCCGG + Intergenic
966928865 3:184662907-184662929 GTTCCCCCCAGCACACCGTCGGG - Intronic
967955887 3:194876906-194876928 CATCCCCCAAGCCCCCAGCCAGG - Intergenic
968006336 3:195245670-195245692 CCTCCCACCAGGCCCCAGTCCGG - Intronic
968450665 4:674627-674649 GTGCGCCCCGGCCCGCAGTCTGG - Intronic
968958704 4:3731850-3731872 CTCCACCCCAGCCTGCACTCCGG - Intergenic
969102399 4:4778950-4778972 CTTCCGCACACCCCGCAGTGTGG + Intergenic
969712147 4:8850470-8850492 CTGCCCCCCAGCCAGGAGCCTGG - Intronic
970325369 4:14918481-14918503 CTTCCCCCAAGCAGGCTGTCAGG - Intergenic
970601877 4:17647201-17647223 CCTCCCCCCTGCCCGAAGTGGGG - Intronic
973193238 4:47410474-47410496 CTGCCCCACATCCCTCAGTCTGG - Intronic
977757347 4:100689039-100689061 CTTCTCCCAATCCTGCAGTCAGG + Intronic
977882994 4:102227340-102227362 CTTCCCCCCAACCCCCTGACAGG - Intergenic
982194518 4:152897269-152897291 CTTCTCCCCAGCACCCACTCAGG - Intronic
983882813 4:172952237-172952259 CCTCCCCCCAGGCAGCAGGCGGG - Exonic
984439232 4:179745781-179745803 CTTCCCCCCAACCCCCTGACAGG - Intergenic
985448979 4:190047495-190047517 CTGCCCCCCAGCCCGCAGTGGGG - Intergenic
985745489 5:1644545-1644567 CTCCCCCGCACCCCGCAGGCAGG + Intergenic
985745500 5:1644610-1644632 CTCCCCCGCACCCCGCAGGCAGG + Intergenic
985745512 5:1644675-1644697 CTCCCCCGCACCCCGCAGGCAGG + Intergenic
985745524 5:1644740-1644762 CTCCCCCGCACCCCGCAGGCAGG + Intergenic
985745536 5:1644805-1644827 CTCCCCCGCACCCCGCAGGCAGG + Intergenic
985745549 5:1644870-1644892 CTCCCCCGCACCCCGCAGGCAGG + Intergenic
985745560 5:1644935-1644957 CTCCCCCGCACCCCGCAGGCAGG + Intergenic
985794114 5:1949425-1949447 CATCGCCCCACCCCGCAGACAGG - Intergenic
986015453 5:3753435-3753457 CCTCCCCCCAGCCTGGTGTCTGG - Intergenic
988344263 5:30017908-30017930 CTTCACCCCAGCCCACATTCAGG + Intergenic
994802756 5:104399769-104399791 CTTCCCCCGAGCCCCCCGACAGG - Intergenic
996639598 5:125736270-125736292 CATCCCTCCAGCCTGCTGTCTGG - Intergenic
998091440 5:139372990-139373012 CTTACCCCCAGAACGCAATCTGG - Intronic
999621598 5:153480124-153480146 CTTCCCCTCATCCTGCAGGCTGG + Intergenic
999849421 5:155522801-155522823 GTTCCCCCCAGGCCTCAGGCTGG + Intergenic
1002212188 5:177605641-177605663 TTTCCCCCCACCCCACAGTTGGG + Intronic
1002466428 5:179411093-179411115 CTTCCCCCCAGCCCTGCGCCTGG + Intergenic
1002662926 5:180803270-180803292 TTTCCCCCCGGCCCCCCGTCGGG - Intronic
1002796046 6:471611-471633 CTACCACCCAGCCCGCTGCCTGG - Intergenic
1002991808 6:2245522-2245544 CTCCCTCCCTGCCCGCAGCCTGG - Exonic
1003213228 6:4086655-4086677 CTTCTCACCAGCCTGCAGTGTGG + Intronic
1003723756 6:8735674-8735696 ATTCCCCACAGCCTTCAGTCCGG - Intergenic
1006179780 6:32147939-32147961 CCACCCTCCAGCCCACAGTCAGG + Intergenic
1008767262 6:54933900-54933922 TTTTCCCCCAGCCCCCAGACTGG - Intronic
1010204925 6:73314414-73314436 CGTCCCCCCACCCCACAGACAGG - Intergenic
1010414999 6:75602316-75602338 CTGCCCGCCAGCCCGCGGACAGG + Exonic
1010679907 6:78786761-78786783 TTTCCCCCCAGCCCCCTGACAGG + Intergenic
1015256287 6:131183187-131183209 CTTCCCCCTTGGCCGCAGGCAGG - Intronic
1016631688 6:146240508-146240530 CTTCCTGCCAGGCTGCAGTCTGG - Intronic
1019194221 6:170271825-170271847 CTCCTCCCCAGCCCGTAGCCCGG - Intergenic
1019312033 7:367581-367603 CTCCTCCCCAGGCTGCAGTCTGG - Intergenic
1019348639 7:542902-542924 CTTCCCCTCACCCCTCAGTCTGG - Intergenic
1019427378 7:983980-984002 CAGCACCCCAGCCCGCAGTTGGG - Intronic
1019543293 7:1560935-1560957 CTTCCCCCCTGCCCGGATTTTGG + Intergenic
1020006278 7:4785224-4785246 CTCCACCCCAGCCCCCAGCCCGG + Intronic
1021139303 7:17004021-17004043 GTTCCACCCAGCCCACAGGCAGG + Intergenic
1021887111 7:25150088-25150110 CTTACCTCCAGCCTGCAGCCTGG - Intronic
1023550215 7:41362117-41362139 CTTCCCTAGAGCCCGCAGTGGGG - Intergenic
1024302318 7:47896643-47896665 CCTCCCCCCAGCACACAGCCAGG + Intronic
1026061818 7:67033317-67033339 CTTGCCCCCATCCTGCTGTCAGG + Intronic
1026146053 7:67747678-67747700 CTTCCTCCCAGCTCCCAGCCAGG - Intergenic
1026716526 7:72794131-72794153 CTTGCCCCCATCCTGCTGTCAGG - Intronic
1027234087 7:76287490-76287512 CTTCCTCCCAGCCTGGAGGCCGG + Intergenic
1029635774 7:101782851-101782873 ATTCCCCCCAGCCAGCATCCTGG + Intergenic
1036738473 8:11340483-11340505 CTTCCCCACACCACGCAGCCAGG - Intergenic
1037789237 8:21921375-21921397 CATCCCCCCAACCCCCAGTAAGG - Intronic
1041644513 8:60237855-60237877 CTTCCCCCCAGCCCACCAACAGG + Intronic
1045060878 8:98409836-98409858 CTTCCCTCCAGCACCCAGCCTGG - Intronic
1047615271 8:126557987-126558009 CTTCCCCCGCGCCCGCCCTCAGG + Intronic
1048986147 8:139736095-139736117 CTTCACCCCTGCCCCCAGTCTGG - Intronic
1048993235 8:139773619-139773641 CTTCCCCACAGCCCCCACCCTGG + Intronic
1049265951 8:141668014-141668036 CATCCCCCCAGTGAGCAGTCAGG - Intergenic
1049266381 8:141670081-141670103 GTTCTCCCCAGCCAGCACTCAGG + Intergenic
1049331631 8:142057110-142057132 CTTCTCCCCAGCTAGAAGTCTGG + Intergenic
1049577997 8:143398390-143398412 CCTGCCCCCACCCCGGAGTCTGG - Intergenic
1049769787 8:144374529-144374551 CCTCCGCCCAGCCCGGAGGCGGG + Intronic
1050086727 9:1973683-1973705 CTTCTTCACAGCCCCCAGTCTGG + Intergenic
1056512187 9:87316597-87316619 CTTCCCCCAAGCACTCAGTGAGG - Intergenic
1057615422 9:96585358-96585380 CTTGCCCCCAACCCCCAGACAGG + Intronic
1059423469 9:114206664-114206686 GTTCCCCCCAGCCCTCATTTGGG - Intronic
1059438413 9:114289684-114289706 CCTTCCCCCAGCCCCCAGACTGG + Intronic
1060338738 9:122753151-122753173 CTCCCACCCAGACCGCAGTGTGG + Intergenic
1060441387 9:123643112-123643134 CTCCCCACCAGCACACAGTCTGG - Intronic
1060897046 9:127224954-127224976 CTTCCCCCGCGCCCTCAGCCCGG - Intronic
1061192097 9:129087975-129087997 CTTGCCCCCAGCACACAGCCTGG - Intronic
1062359176 9:136179275-136179297 CTTCCGCCCACCCTGCAGTAGGG + Intergenic
1062597626 9:137306293-137306315 CTTCTCCCCAGCCCGCCCCCAGG + Intergenic
1202779428 9_KI270717v1_random:22267-22289 CTTACCCAAAGCCCTCAGTCTGG - Intergenic
1203443595 Un_GL000219v1:33934-33956 CTGCCCCCCAGCCAGCAGTGGGG - Intergenic
1203514403 Un_KI270741v1:152843-152865 CTGCCCCCCAGCCAGCAGTGGGG - Intergenic
1185540535 X:899769-899791 CTTTCCCCCAACCCCCAGACAGG + Intergenic
1187243983 X:17537846-17537868 CGTGCCCCCAGCCTCCAGTCGGG - Intronic
1188893878 X:35643180-35643202 GTTCCCCCACCCCCGCAGTCAGG - Intergenic
1191054611 X:56229137-56229159 CTTCCCTCCAGCCCTCAGACTGG + Intergenic
1191757705 X:64612027-64612049 CTTCCTCCCAGGCAGCAGTTTGG - Intergenic
1196425097 X:115561693-115561715 CTTCCCTCCCGCCCGGACTCAGG + Intronic
1198589997 X:138168164-138168186 CTTACCTCCAGACCTCAGTCTGG + Intergenic
1199577183 X:149323697-149323719 GTGGCCCCCAGCCCACAGTCAGG + Intergenic