ID: 1085784866

View in Genome Browser
Species Human (GRCh38)
Location 11:79440260-79440282
Sequence CCCCGGAGCCCGCCGCGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085784866_1085784875 18 Left 1085784866 11:79440260-79440282 CCAGTCCGCGGCGGGCTCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 159
Right 1085784875 11:79440301-79440323 TCCAGAACAGCTTGCCTCTTCGG 0: 1
1: 0
2: 2
3: 16
4: 152
1085784866_1085784873 -6 Left 1085784866 11:79440260-79440282 CCAGTCCGCGGCGGGCTCCGGGG 0: 1
1: 1
2: 1
3: 12
4: 159
Right 1085784873 11:79440277-79440299 CCGGGGGCTGCGGCGGCTCCAGG 0: 1
1: 1
2: 11
3: 89
4: 675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085784866 Original CRISPR CCCCGGAGCCCGCCGCGGAC TGG (reversed) Intronic
900100776 1:961120-961142 CCCCGGAGCGCGCCGTGTCCAGG - Intronic
900204944 1:1427724-1427746 CCCCGGACCCCGCCGCCCCCCGG + Exonic
900349686 1:2228548-2228570 CGCTGGAGCCCGCCGCCGCCCGG - Intergenic
901641187 1:10694020-10694042 CCTCGGCGCCCGCCCGGGACGGG - Intronic
902031078 1:13422655-13422677 CCCAGGAGCCAGCAGGGGACGGG + Intergenic
903077949 1:20786792-20786814 CTCCGAGGCCCGCCGCGGTCCGG - Intronic
904237653 1:29124858-29124880 CCCGGCTGCGCGCCGCGGACAGG + Intergenic
907319674 1:53594571-53594593 CTCCGGAGCCCCCCTCTGACGGG - Exonic
907521019 1:55023483-55023505 CCCCGGTGCCGGTCACGGACTGG + Intergenic
911664636 1:100539259-100539281 CTGCGGAGCCCCCCGCAGACTGG + Exonic
918388836 1:184037361-184037383 CCCCGCCGCCCGCCTCGGCCCGG - Exonic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
921138789 1:212285877-212285899 CCCGGGAGCTCGCCGCGCGCCGG + Exonic
921383895 1:214551206-214551228 CCCCGGAGTCCCGCGCGGAAAGG + Exonic
922048155 1:221966669-221966691 CTCCGGAGCCGGTCACGGACTGG + Intergenic
922925250 1:229342584-229342606 ACCCGGAGCCCCGCCCGGACGGG + Intronic
924944558 1:248837915-248837937 AGCCGGTGCCCGGCGCGGACGGG - Intergenic
1064354236 10:14603831-14603853 CCGCGGCGCCCGGCGTGGACCGG - Intronic
1064662138 10:17617163-17617185 CCTCGGAGGCCGGCGAGGACCGG - Exonic
1065188927 10:23193236-23193258 CCCAGGCGCCCGCCGCCGCCCGG - Exonic
1065844688 10:29735447-29735469 CCCCGGAGCGCGCCTCGGGGAGG - Intronic
1066220557 10:33334244-33334266 CCCAGCTGCCCGCCCCGGACCGG - Intronic
1066429123 10:35336191-35336213 CCCCGGGGCCCGCAGCGGGCGGG - Intronic
1069521396 10:69124321-69124343 TCCCGGAGCGCGCGGCGGGCCGG + Intronic
1077076089 11:702879-702901 CCCTGGAGCCCACCGCCCACAGG - Intronic
1077177803 11:1198511-1198533 CCCCGGAGCCCCCCGGAGCCAGG - Intronic
1077250235 11:1557596-1557618 CCCAGGCGCCCGCCGGGGCCAGG + Intronic
1078801159 11:14644641-14644663 CCCCGGAGGCGGCAGCGGGCAGG + Exonic
1080503690 11:32892916-32892938 CCTCGCCGCCCGCCGCGGCCCGG + Intergenic
1081749899 11:45502306-45502328 CCCCGGCTCCTGCCGTGGACAGG + Intergenic
1082168033 11:48968891-48968913 CCCCAGAGGCCGGCGCGGAAGGG - Intergenic
1082235512 11:49817745-49817767 CCCCAGAGGCCGGCGCGGAAGGG + Intergenic
1083727970 11:64638146-64638168 CCCCGAGGCCCGCGGCGCACAGG + Intronic
1084265603 11:68003851-68003873 CCCCGGTGCCCGCCGCCCCCCGG + Intronic
1084973025 11:72781679-72781701 CGCCGGGGCCCGCCGGGGCCGGG + Intronic
1085423081 11:76380664-76380686 CCCGGGAGCCCGCCAGGGGCCGG + Intronic
1085784866 11:79440260-79440282 CCCCGGAGCCCGCCGCGGACTGG - Intronic
1089687934 11:120168881-120168903 CCTCGGAGCCCAGCGCGGAGAGG + Intronic
1091460850 12:642808-642830 GCCCCGAGCGCGCCGCAGACCGG + Intronic
1091740750 12:2959232-2959254 CCCCGCCGCCCGCCCCGGCCCGG + Intergenic
1093958922 12:25251319-25251341 CCGCACAGCCCGCCGCGGTCCGG - Intergenic
1097872092 12:64610393-64610415 CCCTGGGCCCCGCCCCGGACGGG - Intergenic
1098963782 12:76764517-76764539 TCCCAGAGCCCGCCCCGGTCGGG - Intronic
1102239022 12:111312235-111312257 CCCCGGGGCCAGCTGCGAACAGG + Intronic
1103595506 12:122022425-122022447 CCCCGGCGCCCGCCGCCTCCGGG - Intronic
1104602352 12:130162315-130162337 CCCGGGAGCCCGCGGCGGGGCGG + Intergenic
1105022719 12:132828239-132828261 CCGCGGAGCCCACCTAGGACAGG - Intronic
1105074638 12:133264893-133264915 ACCCGGACCCCGACCCGGACCGG - Intergenic
1106264887 13:28100777-28100799 CCCCGGGGGCCGCCGAGCACAGG - Intergenic
1106776672 13:33016325-33016347 CAGCGGAGCCCGCCGGGGAGCGG + Intergenic
1108484547 13:50910436-50910458 CTCCGGGGCCCGCAGCGCACCGG - Intronic
1115492618 14:33972860-33972882 CCCTGGAGCCCGCTGCACACTGG - Intronic
1119731948 14:76956668-76956690 CCCCCTCGCCCGCCGCGGGCCGG + Intergenic
1120788035 14:88554757-88554779 CCCATGAGCGCGCCGCGGCCCGG - Intergenic
1122131024 14:99604521-99604543 GCCGGGAGCCGGCCGCGGGCGGG - Intergenic
1122719954 14:103716225-103716247 TCCCGGCGCCCGCCCTGGACAGG - Intronic
1124426907 15:29570468-29570490 CCCCGGAGCCCGTCCCCGCCTGG + Intronic
1124584378 15:30991683-30991705 CCCCGGCGCCCGCGTCGGCCTGG - Intergenic
1127588209 15:60397816-60397838 CCCCGGAGGCCGTCGGGGGCAGG - Intronic
1127868288 15:63048846-63048868 CCCCAGAGCCCGCCGCCAGCTGG - Intronic
1128228614 15:66019592-66019614 CCCCGCAGCCAGCAGCAGACCGG + Intronic
1130086021 15:80779181-80779203 CGCCAGAGCCCGCCCCGGTCCGG + Intergenic
1130531056 15:84748356-84748378 CCGCGCAGCCCGCCTCGGGCGGG + Intergenic
1131272660 15:90956683-90956705 CCCCCGGGCCCGCCGCAGCCAGG + Exonic
1131731898 15:95290711-95290733 CCCCGGAGCCGGCCGCCAAACGG + Intergenic
1132886511 16:2184666-2184688 CCCCCGACCCCGCCGCTGCCAGG + Intronic
1133156742 16:3881017-3881039 TCCCGGAGCCCGCTGGGGCCCGG - Intergenic
1133869873 16:9676485-9676507 CTCCGGTGCCCGTCACGGACTGG - Intronic
1135517631 16:23148996-23149018 CTGCGGAGGCCGCCGCGGTCTGG + Exonic
1136428224 16:30183272-30183294 CCTCGGTGCCCGCCCCGGCCCGG - Intronic
1136544652 16:30948497-30948519 CCCCGGAGGCCTGCGCGGAGGGG - Exonic
1139386986 16:66579237-66579259 CCCCCGACCCCGCAGCGGAGCGG + Intergenic
1141538422 16:84699790-84699812 ACCAGGAGCCCGCCGAGGCCTGG - Intergenic
1141989493 16:87602274-87602296 CCCCGGGGCCCCCGCCGGACTGG - Intronic
1142132634 16:88437918-88437940 CCCCTGGGCCCGGCGAGGACAGG + Exonic
1142227410 16:88884334-88884356 CCCAGGAGCCCCCCCAGGACAGG - Intronic
1142664740 17:1456172-1456194 CCCCGGCGCCCGCCGCCCAGCGG + Exonic
1145077395 17:19867426-19867448 CCCCGGGGCACACAGCGGACGGG + Exonic
1148772870 17:50077031-50077053 CCCCGGAGCGCTCCGAGGTCCGG - Exonic
1148782448 17:50129619-50129641 GCCCGGAGCCCCCCGCGGCCGGG - Exonic
1148805114 17:50260002-50260024 CCCCCGAGCAGGCCGGGGACTGG - Intergenic
1151478695 17:74357553-74357575 CCCCGGTGCCCACCGCGTAGTGG + Exonic
1152357942 17:79815594-79815616 CCCCGCAGCCACCCGCGCACGGG + Intergenic
1152563399 17:81089692-81089714 CCCCGGAGCCCGGCAGGGTCAGG + Intronic
1155540383 18:26863397-26863419 CCCGGGAGCCTGCCACGGGCCGG - Intronic
1156502361 18:37567574-37567596 CCCCGCAGCCCGCGGGGGAGCGG - Intergenic
1160038398 18:75321871-75321893 CCACGGAGCCCAGCGAGGACTGG + Intergenic
1160562830 18:79770459-79770481 CCCCGGAGCCGGCCCAGCACGGG + Intergenic
1160745376 19:708930-708952 CCCCCGCGCCCGCCGCCGCCCGG + Intergenic
1160769138 19:822398-822420 CCGCGGAGCCCGCCGCTCGCTGG + Intergenic
1160877716 19:1304947-1304969 CCTCGGTGCCCGCCGCGGGCAGG + Intergenic
1161487478 19:4543788-4543810 CCCTGGAGCCCGCCCCCGACGGG - Exonic
1162100471 19:8335631-8335653 CCCCGCTGCCCGCCGCGCCCCGG - Exonic
1162395659 19:10416963-10416985 CCCCGGTCCCTGCCACGGACAGG - Intronic
1162959528 19:14117768-14117790 CCCCGCAGCCCGCCGCTCATTGG + Intronic
1163102676 19:15107626-15107648 CCCCGCACCCCGCTGCAGACTGG + Intronic
1163556600 19:17996941-17996963 CCACGGAGGCCGCCGCGGGGTGG + Intronic
1165461111 19:35944931-35944953 CCCCGGAGCCCGCGGCGCTCAGG + Exonic
1166079341 19:40434029-40434051 CCCGGGAGGCGGCCGCGGCCGGG - Intergenic
1167258004 19:48442688-48442710 CCCGGGAGCCGGCCGCGGCGCGG - Exonic
1168297455 19:55384311-55384333 CCCCTGACCCCGCCCCGGACCGG - Exonic
927751472 2:25673738-25673760 GCCCGGAACCCGCCGGCGACCGG - Intergenic
929936392 2:46297257-46297279 GCCCGGAGCTCGGCGCGGGCGGG + Intronic
931052280 2:58428410-58428432 CCTCGGAGCCCGCGGCGGCTCGG - Intergenic
935196676 2:100820370-100820392 CCGCGGGGCCGGGCGCGGACTGG - Exonic
936433267 2:112482241-112482263 CCCGGGCGCCCGCCGCGGCCCGG - Exonic
940774910 2:157875795-157875817 CCTCGGGTCCCGCCGCGGCCGGG + Intronic
941112143 2:161427261-161427283 CCCTGGAGCCCGGCGCTGCCCGG + Intronic
943342134 2:186694111-186694133 CCCTGGCGCCCGCCGCCGCCCGG + Exonic
946250086 2:218406409-218406431 CGCCGGAGCCCGCCGCACCCAGG - Intergenic
946306266 2:218858727-218858749 CCCCGGGGCACGTCGGGGACGGG + Intergenic
948477820 2:238231717-238231739 TCCCAGAGGCCGCCGCGGCCCGG - Intergenic
949014497 2:241701896-241701918 CCCCGCAGCCCGCCGCCCGCCGG + Intergenic
1168802672 20:653297-653319 CCCCCGACCCCGCCGCGGTCCGG + Exonic
1172771671 20:37385832-37385854 CCCCGGGGACGGACGCGGACAGG + Intronic
1173599938 20:44287448-44287470 CCCCAAAGCCCGCCCCGAACAGG + Intergenic
1174506938 20:51023083-51023105 ACTCGGAGCCCGGCGGGGACCGG - Exonic
1175945935 20:62558787-62558809 CCACGGGGCCCCCCGGGGACAGG - Intronic
1176221112 20:63969751-63969773 CCCCGGCGCCCACCGCGCCCCGG - Intronic
1176550569 21:8219157-8219179 CCCCGGACCCCGTCCCGGCCCGG - Intergenic
1176569499 21:8402198-8402220 CCCCGGACCCCGTCCCGGCCCGG - Intergenic
1176577411 21:8446427-8446449 CCCCGGACCCCGTCCCGGCCCGG - Intergenic
1177349309 21:19914183-19914205 TCCCGGGGCCCCCCGCTGACTGG + Intergenic
1179675016 21:42975059-42975081 GCGCGGAGCCCGGCGCGGGCGGG + Intronic
1181312526 22:21952876-21952898 CCGCGGCGCCCGCGGCGGCCAGG - Intergenic
1184766901 22:46576975-46576997 CCCCCGAGCCGGCCGCGGGGCGG + Intronic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
1203255468 22_KI270733v1_random:135500-135522 CCCCGGACCCCGTCCCGGCCCGG - Intergenic
952788045 3:37175900-37175922 CCCGGGAGCCCGCCGCGGGCCGG + Intronic
956178933 3:66500376-66500398 GCCCCGAGCCCTCCCCGGACCGG + Exonic
968520800 4:1033927-1033949 CCCCGGAGCCCGCAGAGCTCAGG + Intergenic
968541647 4:1171228-1171250 CCCCGGACCCCGCCCCCGGCCGG + Intronic
968701368 4:2059630-2059652 CCCCGCTGCCCGCCGCGCCCGGG + Exonic
969393998 4:6909337-6909359 GCCCGGGCCCCGCCGCGGAAGGG - Intronic
971351821 4:25862625-25862647 CCCCGGGGCCCCGCGCGGAGGGG + Intronic
984973585 4:185210425-185210447 GCCCGGAGCCCGCCGCGCGCGGG - Intronic
985006011 4:185535666-185535688 CCCCCGCGCCCGCCGCGGCCCGG - Intergenic
985269339 4:188179241-188179263 CGCAGGAGCCCGCAGCGGAGGGG - Intergenic
989480557 5:41925558-41925580 CCCTGGAGCCCCCCGGGGCCTGG + Intronic
998583394 5:143403421-143403443 CCGCGGAGCCCGGCGCGGGGCGG - Exonic
999091264 5:148938167-148938189 GCCTGGAGTCCGCCGCAGACTGG + Intronic
1002133098 5:177093193-177093215 CCAGGGAGCCCGACGCGTACAGG - Exonic
1002541164 5:179907523-179907545 CCCGGGAGCCGGGCGCGGAGGGG - Intronic
1002692489 5:181059834-181059856 CCGCGGACCCCGCCCTGGACTGG + Exonic
1002897944 6:1389999-1390021 GCCTGGAGCGCGCCGGGGACCGG - Exonic
1004248482 6:14002672-14002694 CGCAGGAGCCCACCGCGGGCGGG - Intergenic
1004864226 6:19837663-19837685 GAGCGGAGCCGGCCGCGGACGGG + Exonic
1007673479 6:43575953-43575975 CCCCGCCGCCCGCCGCGGCCCGG - Exonic
1014925587 6:127266858-127266880 CCTCGGAGCCCGCAGCTGCCGGG - Exonic
1017662428 6:156687454-156687476 CCGCCGAGGCCGCCGCGGCCGGG - Intergenic
1017709006 6:157148960-157148982 CCCAGGAGCACGCCCCGGGCAGG + Intronic
1018774435 6:166999706-166999728 TCCCGGAGGGCACCGCGGACTGG + Intronic
1019149063 6:169992559-169992581 CCCCGCAGCCCGTCCAGGACAGG + Intergenic
1024471747 7:49773756-49773778 CCCCGAACCCCTCCGCGGAGAGG + Exonic
1031162461 7:118184335-118184357 CCCAGGATCCCGCCGAGGCCAGG - Intronic
1032306297 7:130734447-130734469 CCCCGCAGCCCGCCGCCCGCTGG + Intergenic
1034147360 7:148884623-148884645 GCCCGGAGCCCGCCGCGGACGGG + Intergenic
1034951230 7:155298109-155298131 GCCCGGGGCCAGCGGCGGACGGG - Intronic
1036739517 8:11347901-11347923 CTCCGGAGCCCGGCGCGGGGAGG + Intergenic
1041511506 8:58659353-58659375 GGCCGGAGCCTGCCGGGGACAGG - Exonic
1041558614 8:59188046-59188068 CCCCGAAGCCTGCTGTGGACTGG + Intergenic
1049536350 8:143184179-143184201 CCATGGAGCCCGCCTCGGGCTGG - Intergenic
1057436555 9:95045557-95045579 ACCCAGAGCCCTCCGCGGAGAGG - Intronic
1061482021 9:130902097-130902119 CCCAGGAGCCCCCCACCGACAGG - Intergenic
1062110782 9:134781000-134781022 CCCCGCAGGCCGCCGTGGCCAGG - Intronic
1062600873 9:137318130-137318152 ACCTGGAGCCTGCCGTGGACAGG - Intronic
1203471864 Un_GL000220v1:118635-118657 CCCCGGACCCCGTCCCGGCCCGG - Intergenic
1190337388 X:49270467-49270489 CCGCGCAGCCCGCCGTGGGCAGG + Exonic
1192510750 X:71719225-71719247 CCCCGGAGCCCCACGGGGCCAGG + Intergenic
1192515947 X:71762328-71762350 CCCCGGAGCCCCACGGGGCCAGG - Intergenic
1195220564 X:102742316-102742338 CCCCCGACCCCGCCCCCGACTGG - Intronic
1200057591 X:153469873-153469895 CCACTGAGCCAGTCGCGGACAGG + Intronic
1200063038 X:153492026-153492048 CCCAGGAACCCGCGGCAGACAGG - Intronic
1200411770 Y:2868339-2868361 CCCCAGTGCCCGCCTCTGACAGG + Intronic