ID: 1085787580

View in Genome Browser
Species Human (GRCh38)
Location 11:79468679-79468701
Sequence TGTTCTCAGTTACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085787577_1085787580 4 Left 1085787577 11:79468652-79468674 CCTCAGGACCAGAAACAAAATAC No data
Right 1085787580 11:79468679-79468701 TGTTCTCAGTTACCACAAGCTGG No data
1085787578_1085787580 -4 Left 1085787578 11:79468660-79468682 CCAGAAACAAAATACCACATGTT No data
Right 1085787580 11:79468679-79468701 TGTTCTCAGTTACCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085787580 Original CRISPR TGTTCTCAGTTACCACAAGC TGG Intergenic
No off target data available for this crispr