ID: 1085789729

View in Genome Browser
Species Human (GRCh38)
Location 11:79486620-79486642
Sequence GTGGGCTCACTCTCTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085789726_1085789729 2 Left 1085789726 11:79486595-79486617 CCTAAATACTTGAAGGAAAATAA No data
Right 1085789729 11:79486620-79486642 GTGGGCTCACTCTCTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085789729 Original CRISPR GTGGGCTCACTCTCTTCTCC AGG Intergenic
No off target data available for this crispr