ID: 1085797935 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:79560665-79560687 |
| Sequence | CTATTTACATATATGCAGCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1085797931_1085797935 | 26 | Left | 1085797931 | 11:79560616-79560638 | CCTGGGATTTCTTAGATACTATG | No data | ||
| Right | 1085797935 | 11:79560665-79560687 | CTATTTACATATATGCAGCTAGG | No data | ||||
| 1085797930_1085797935 | 27 | Left | 1085797930 | 11:79560615-79560637 | CCCTGGGATTTCTTAGATACTAT | No data | ||
| Right | 1085797935 | 11:79560665-79560687 | CTATTTACATATATGCAGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1085797935 | Original CRISPR | CTATTTACATATATGCAGCT AGG | Intergenic | ||
| No off target data available for this crispr | |||||