ID: 1085797935

View in Genome Browser
Species Human (GRCh38)
Location 11:79560665-79560687
Sequence CTATTTACATATATGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085797931_1085797935 26 Left 1085797931 11:79560616-79560638 CCTGGGATTTCTTAGATACTATG No data
Right 1085797935 11:79560665-79560687 CTATTTACATATATGCAGCTAGG No data
1085797930_1085797935 27 Left 1085797930 11:79560615-79560637 CCCTGGGATTTCTTAGATACTAT No data
Right 1085797935 11:79560665-79560687 CTATTTACATATATGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085797935 Original CRISPR CTATTTACATATATGCAGCT AGG Intergenic
No off target data available for this crispr