ID: 1085799149

View in Genome Browser
Species Human (GRCh38)
Location 11:79571992-79572014
Sequence CTGTGTGATCTCAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085799149_1085799152 -1 Left 1085799149 11:79571992-79572014 CCAACTTGCTTGAGATCACACAG No data
Right 1085799152 11:79572014-79572036 GCTAACAAATGGTGAAGGCAAGG No data
1085799149_1085799151 -6 Left 1085799149 11:79571992-79572014 CCAACTTGCTTGAGATCACACAG No data
Right 1085799151 11:79572009-79572031 ACACAGCTAACAAATGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085799149 Original CRISPR CTGTGTGATCTCAAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr