ID: 1085805033

View in Genome Browser
Species Human (GRCh38)
Location 11:79627923-79627945
Sequence GACTCAGATGTGACTTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085805033_1085805035 9 Left 1085805033 11:79627923-79627945 CCTTACAAAGTCACATCTGAGTC No data
Right 1085805035 11:79627955-79627977 TGGCTAAATGCATTTGTCTAAGG No data
1085805033_1085805036 19 Left 1085805033 11:79627923-79627945 CCTTACAAAGTCACATCTGAGTC No data
Right 1085805036 11:79627965-79627987 CATTTGTCTAAGGAACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085805033 Original CRISPR GACTCAGATGTGACTTTGTA AGG (reversed) Intergenic
No off target data available for this crispr