ID: 1085812053

View in Genome Browser
Species Human (GRCh38)
Location 11:79692190-79692212
Sequence ATTTGATTCTAGGAGTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085812053_1085812058 14 Left 1085812053 11:79692190-79692212 CCTTAATACTCCTAGAATCAAAT No data
Right 1085812058 11:79692227-79692249 TTGTTATATAGTAGAAAGGAAGG No data
1085812053_1085812057 10 Left 1085812053 11:79692190-79692212 CCTTAATACTCCTAGAATCAAAT No data
Right 1085812057 11:79692223-79692245 GAGCTTGTTATATAGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085812053 Original CRISPR ATTTGATTCTAGGAGTATTA AGG (reversed) Intergenic
No off target data available for this crispr