ID: 1085814101

View in Genome Browser
Species Human (GRCh38)
Location 11:79717335-79717357
Sequence TACCCAAGGAAACTGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085814101_1085814104 16 Left 1085814101 11:79717335-79717357 CCCTTCTTCAGTTTCCTTGGGTA No data
Right 1085814104 11:79717374-79717396 TTTCTTCATTTTCCAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085814101 Original CRISPR TACCCAAGGAAACTGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr