ID: 1085818441

View in Genome Browser
Species Human (GRCh38)
Location 11:79766892-79766914
Sequence GCTTGAATTCCTCTAGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085818440_1085818441 -2 Left 1085818440 11:79766871-79766893 CCAAATGGACATTCAGATGCTGC No data
Right 1085818441 11:79766892-79766914 GCTTGAATTCCTCTAGTGACAGG No data
1085818439_1085818441 1 Left 1085818439 11:79766868-79766890 CCACCAAATGGACATTCAGATGC No data
Right 1085818441 11:79766892-79766914 GCTTGAATTCCTCTAGTGACAGG No data
1085818438_1085818441 9 Left 1085818438 11:79766860-79766882 CCATAGCTCCACCAAATGGACAT No data
Right 1085818441 11:79766892-79766914 GCTTGAATTCCTCTAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085818441 Original CRISPR GCTTGAATTCCTCTAGTGAC AGG Intergenic
No off target data available for this crispr