ID: 1085823351

View in Genome Browser
Species Human (GRCh38)
Location 11:79816983-79817005
Sequence ACATGCTCCCAGCCAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085823346_1085823351 26 Left 1085823346 11:79816934-79816956 CCACTGACTGTAACACTTTTTGA No data
Right 1085823351 11:79816983-79817005 ACATGCTCCCAGCCAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085823351 Original CRISPR ACATGCTCCCAGCCAATGTC TGG Intergenic
No off target data available for this crispr