ID: 1085834502

View in Genome Browser
Species Human (GRCh38)
Location 11:79937897-79937919
Sequence CTATATATGCAAAAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085834502_1085834505 0 Left 1085834502 11:79937897-79937919 CCATCCATCTTTTGCATATATAG No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085834502 Original CRISPR CTATATATGCAAAAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr