ID: 1085834505

View in Genome Browser
Species Human (GRCh38)
Location 11:79937920-79937942
Sequence TCATCCCTTGGTATTTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085834498_1085834505 24 Left 1085834498 11:79937873-79937895 CCTGTAGAAAGTTATTCTACCCT No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data
1085834503_1085834505 -4 Left 1085834503 11:79937901-79937923 CCATCTTTTGCATATATAGTCAT No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data
1085834501_1085834505 1 Left 1085834501 11:79937896-79937918 CCCATCCATCTTTTGCATATATA No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data
1085834500_1085834505 4 Left 1085834500 11:79937893-79937915 CCTCCCATCCATCTTTTGCATAT No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data
1085834497_1085834505 25 Left 1085834497 11:79937872-79937894 CCCTGTAGAAAGTTATTCTACCC No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data
1085834499_1085834505 5 Left 1085834499 11:79937892-79937914 CCCTCCCATCCATCTTTTGCATA No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data
1085834502_1085834505 0 Left 1085834502 11:79937897-79937919 CCATCCATCTTTTGCATATATAG No data
Right 1085834505 11:79937920-79937942 TCATCCCTTGGTATTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085834505 Original CRISPR TCATCCCTTGGTATTTGTGA AGG Intergenic
No off target data available for this crispr