ID: 1085836192 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:79959316-79959338 |
Sequence | CACGCTTCACAGATCGAAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1085836192_1085836196 | 21 | Left | 1085836192 | 11:79959316-79959338 | CCACTTTCGATCTGTGAAGCGTG | No data | ||
Right | 1085836196 | 11:79959360-79959382 | GAGTCCCAGTTTGCCTCATCTGG | No data | ||||
1085836192_1085836195 | -1 | Left | 1085836192 | 11:79959316-79959338 | CCACTTTCGATCTGTGAAGCGTG | No data | ||
Right | 1085836195 | 11:79959338-79959360 | GGGTCAGCTTTGCTACATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1085836192 | Original CRISPR | CACGCTTCACAGATCGAAAG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |