ID: 1085836192

View in Genome Browser
Species Human (GRCh38)
Location 11:79959316-79959338
Sequence CACGCTTCACAGATCGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085836192_1085836196 21 Left 1085836192 11:79959316-79959338 CCACTTTCGATCTGTGAAGCGTG No data
Right 1085836196 11:79959360-79959382 GAGTCCCAGTTTGCCTCATCTGG No data
1085836192_1085836195 -1 Left 1085836192 11:79959316-79959338 CCACTTTCGATCTGTGAAGCGTG No data
Right 1085836195 11:79959338-79959360 GGGTCAGCTTTGCTACATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085836192 Original CRISPR CACGCTTCACAGATCGAAAG TGG (reversed) Intergenic
No off target data available for this crispr