ID: 1085836627

View in Genome Browser
Species Human (GRCh38)
Location 11:79963471-79963493
Sequence GTCTATTTATCCCTAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085836627_1085836635 20 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836635 11:79963514-79963536 TTGGAACCATGGTGAGCTGCTGG No data
1085836627_1085836637 22 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836637 11:79963516-79963538 GGAACCATGGTGAGCTGCTGGGG No data
1085836627_1085836629 -7 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836629 11:79963487-79963509 AATAGACAGTGCCCACAGATAGG No data
1085836627_1085836631 1 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836631 11:79963495-79963517 GTGCCCACAGATAGGGTATTTGG No data
1085836627_1085836630 -6 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836630 11:79963488-79963510 ATAGACAGTGCCCACAGATAGGG No data
1085836627_1085836634 9 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836634 11:79963503-79963525 AGATAGGGTATTTGGAACCATGG 0: 2
1: 0
2: 0
3: 9
4: 157
1085836627_1085836638 23 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG No data
1085836627_1085836636 21 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836636 11:79963515-79963537 TGGAACCATGGTGAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085836627 Original CRISPR GTCTATTTATCCCTAAAAGA GGG (reversed) Intergenic
No off target data available for this crispr