ID: 1085836633

View in Genome Browser
Species Human (GRCh38)
Location 11:79963499-79963521
Sequence GGTTCCAAATACCCTATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085836633_1085836638 -5 Left 1085836633 11:79963499-79963521 CCACAGATAGGGTATTTGGAACC No data
Right 1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG No data
1085836633_1085836636 -7 Left 1085836633 11:79963499-79963521 CCACAGATAGGGTATTTGGAACC No data
Right 1085836636 11:79963515-79963537 TGGAACCATGGTGAGCTGCTGGG No data
1085836633_1085836637 -6 Left 1085836633 11:79963499-79963521 CCACAGATAGGGTATTTGGAACC No data
Right 1085836637 11:79963516-79963538 GGAACCATGGTGAGCTGCTGGGG No data
1085836633_1085836635 -8 Left 1085836633 11:79963499-79963521 CCACAGATAGGGTATTTGGAACC No data
Right 1085836635 11:79963514-79963536 TTGGAACCATGGTGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085836633 Original CRISPR GGTTCCAAATACCCTATCTG TGG (reversed) Intergenic
No off target data available for this crispr