ID: 1085836638

View in Genome Browser
Species Human (GRCh38)
Location 11:79963517-79963539
Sequence GAACCATGGTGAGCTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085836632_1085836638 -4 Left 1085836632 11:79963498-79963520 CCCACAGATAGGGTATTTGGAAC No data
Right 1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG No data
1085836633_1085836638 -5 Left 1085836633 11:79963499-79963521 CCACAGATAGGGTATTTGGAACC No data
Right 1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG No data
1085836627_1085836638 23 Left 1085836627 11:79963471-79963493 CCCTCTTTTAGGGATAAATAGAC No data
Right 1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG No data
1085836628_1085836638 22 Left 1085836628 11:79963472-79963494 CCTCTTTTAGGGATAAATAGACA No data
Right 1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085836638 Original CRISPR GAACCATGGTGAGCTGCTGG GGG Intergenic
No off target data available for this crispr