ID: 1085837936

View in Genome Browser
Species Human (GRCh38)
Location 11:79976225-79976247
Sequence CTGCAGACACAGATGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085837929_1085837936 2 Left 1085837929 11:79976200-79976222 CCCATGAACTGGGGACCCAGGAC No data
Right 1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG No data
1085837921_1085837936 29 Left 1085837921 11:79976173-79976195 CCCATCAGCTAAAGATTAGTGAG No data
Right 1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG No data
1085837922_1085837936 28 Left 1085837922 11:79976174-79976196 CCATCAGCTAAAGATTAGTGAGG No data
Right 1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG No data
1085837930_1085837936 1 Left 1085837930 11:79976201-79976223 CCATGAACTGGGGACCCAGGACC No data
Right 1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085837936 Original CRISPR CTGCAGACACAGATGGAGAT GGG Intergenic
No off target data available for this crispr