ID: 1085840620

View in Genome Browser
Species Human (GRCh38)
Location 11:80007866-80007888
Sequence GACAGGGAAATTCCTAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085840620_1085840628 14 Left 1085840620 11:80007866-80007888 CCCACCCTAGGAATTTCCCTGTC No data
Right 1085840628 11:80007903-80007925 AACTTTGATTATCCAGGCTTGGG No data
1085840620_1085840627 13 Left 1085840620 11:80007866-80007888 CCCACCCTAGGAATTTCCCTGTC No data
Right 1085840627 11:80007902-80007924 GAACTTTGATTATCCAGGCTTGG No data
1085840620_1085840626 8 Left 1085840620 11:80007866-80007888 CCCACCCTAGGAATTTCCCTGTC No data
Right 1085840626 11:80007897-80007919 AAAAAGAACTTTGATTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085840620 Original CRISPR GACAGGGAAATTCCTAGGGT GGG (reversed) Intergenic
No off target data available for this crispr