ID: 1085842071

View in Genome Browser
Species Human (GRCh38)
Location 11:80023587-80023609
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085842071_1085842075 7 Left 1085842071 11:80023587-80023609 CCATCCTCCTCCTGATGACACAC No data
Right 1085842075 11:80023617-80023639 CACTCCCACACAGATATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085842071 Original CRISPR GTGTGTCATCAGGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr