ID: 1085843575 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:80041118-80041140 |
| Sequence | CAGGAGCATCTGGCAGAGTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1085843575_1085843579 | 25 | Left | 1085843575 | 11:80041118-80041140 | CCTTACTCTGCCAGATGCTCCTG | No data | ||
| Right | 1085843579 | 11:80041166-80041188 | ACTCAACCAAAGAATCGCAGTGG | No data | ||||
| 1085843575_1085843577 | -5 | Left | 1085843575 | 11:80041118-80041140 | CCTTACTCTGCCAGATGCTCCTG | No data | ||
| Right | 1085843577 | 11:80041136-80041158 | TCCTGCACAGTTTTGCACATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1085843575 | Original CRISPR | CAGGAGCATCTGGCAGAGTA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||