ID: 1085843575

View in Genome Browser
Species Human (GRCh38)
Location 11:80041118-80041140
Sequence CAGGAGCATCTGGCAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085843575_1085843579 25 Left 1085843575 11:80041118-80041140 CCTTACTCTGCCAGATGCTCCTG No data
Right 1085843579 11:80041166-80041188 ACTCAACCAAAGAATCGCAGTGG No data
1085843575_1085843577 -5 Left 1085843575 11:80041118-80041140 CCTTACTCTGCCAGATGCTCCTG No data
Right 1085843577 11:80041136-80041158 TCCTGCACAGTTTTGCACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085843575 Original CRISPR CAGGAGCATCTGGCAGAGTA AGG (reversed) Intergenic
No off target data available for this crispr