ID: 1085849820

View in Genome Browser
Species Human (GRCh38)
Location 11:80107138-80107160
Sequence TAGACTTTGAATAAAATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085849820_1085849821 -6 Left 1085849820 11:80107138-80107160 CCAGGTATTTTATTCAAAGTCTA No data
Right 1085849821 11:80107155-80107177 AGTCTACATATGTAACAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085849820 Original CRISPR TAGACTTTGAATAAAATACC TGG (reversed) Intergenic
No off target data available for this crispr