ID: 1085854239

View in Genome Browser
Species Human (GRCh38)
Location 11:80158053-80158075
Sequence CTCAAATAGCTGTCAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085854239_1085854240 0 Left 1085854239 11:80158053-80158075 CCTTTGTCTGACAGCTATTTGAG No data
Right 1085854240 11:80158076-80158098 AAGTATTATTACATATGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085854239 Original CRISPR CTCAAATAGCTGTCAGACAA AGG (reversed) Intergenic
No off target data available for this crispr