ID: 1085859643

View in Genome Browser
Species Human (GRCh38)
Location 11:80216727-80216749
Sequence TTCTGAGGGATAGTTTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085859643_1085859648 3 Left 1085859643 11:80216727-80216749 CCCAGGTAAACTATCCCTCAGAA No data
Right 1085859648 11:80216753-80216775 AAGGAGAAATAGTATTTTCCAGG No data
1085859643_1085859649 16 Left 1085859643 11:80216727-80216749 CCCAGGTAAACTATCCCTCAGAA No data
Right 1085859649 11:80216766-80216788 ATTTTCCAGGCAAGCAAAAATGG No data
1085859643_1085859650 19 Left 1085859643 11:80216727-80216749 CCCAGGTAAACTATCCCTCAGAA No data
Right 1085859650 11:80216769-80216791 TTCCAGGCAAGCAAAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085859643 Original CRISPR TTCTGAGGGATAGTTTACCT GGG (reversed) Intergenic
No off target data available for this crispr