ID: 1085859646

View in Genome Browser
Species Human (GRCh38)
Location 11:80216741-80216763
Sequence TATTTCTCCTTCATTTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4515
Summary {0: 39, 1: 229, 2: 839, 3: 1388, 4: 2020}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085859646_1085859650 5 Left 1085859646 11:80216741-80216763 CCCTCAGAAATGAAGGAGAAATA 0: 39
1: 229
2: 839
3: 1388
4: 2020
Right 1085859650 11:80216769-80216791 TTCCAGGCAAGCAAAAATGGAGG No data
1085859646_1085859649 2 Left 1085859646 11:80216741-80216763 CCCTCAGAAATGAAGGAGAAATA 0: 39
1: 229
2: 839
3: 1388
4: 2020
Right 1085859649 11:80216766-80216788 ATTTTCCAGGCAAGCAAAAATGG No data
1085859646_1085859652 22 Left 1085859646 11:80216741-80216763 CCCTCAGAAATGAAGGAGAAATA 0: 39
1: 229
2: 839
3: 1388
4: 2020
Right 1085859652 11:80216786-80216808 TGGAGGAAATTCATCACCACTGG No data
1085859646_1085859653 27 Left 1085859646 11:80216741-80216763 CCCTCAGAAATGAAGGAGAAATA 0: 39
1: 229
2: 839
3: 1388
4: 2020
Right 1085859653 11:80216791-80216813 GAAATTCATCACCACTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085859646 Original CRISPR TATTTCTCCTTCATTTCTGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr