ID: 1085859647

View in Genome Browser
Species Human (GRCh38)
Location 11:80216742-80216764
Sequence CTATTTCTCCTTCATTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085859647_1085859649 1 Left 1085859647 11:80216742-80216764 CCTCAGAAATGAAGGAGAAATAG No data
Right 1085859649 11:80216766-80216788 ATTTTCCAGGCAAGCAAAAATGG No data
1085859647_1085859650 4 Left 1085859647 11:80216742-80216764 CCTCAGAAATGAAGGAGAAATAG No data
Right 1085859650 11:80216769-80216791 TTCCAGGCAAGCAAAAATGGAGG No data
1085859647_1085859653 26 Left 1085859647 11:80216742-80216764 CCTCAGAAATGAAGGAGAAATAG No data
Right 1085859653 11:80216791-80216813 GAAATTCATCACCACTGGACTGG No data
1085859647_1085859652 21 Left 1085859647 11:80216742-80216764 CCTCAGAAATGAAGGAGAAATAG No data
Right 1085859652 11:80216786-80216808 TGGAGGAAATTCATCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085859647 Original CRISPR CTATTTCTCCTTCATTTCTG AGG (reversed) Intergenic
No off target data available for this crispr