ID: 1085859650

View in Genome Browser
Species Human (GRCh38)
Location 11:80216769-80216791
Sequence TTCCAGGCAAGCAAAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085859643_1085859650 19 Left 1085859643 11:80216727-80216749 CCCAGGTAAACTATCCCTCAGAA No data
Right 1085859650 11:80216769-80216791 TTCCAGGCAAGCAAAAATGGAGG No data
1085859647_1085859650 4 Left 1085859647 11:80216742-80216764 CCTCAGAAATGAAGGAGAAATAG No data
Right 1085859650 11:80216769-80216791 TTCCAGGCAAGCAAAAATGGAGG No data
1085859644_1085859650 18 Left 1085859644 11:80216728-80216750 CCAGGTAAACTATCCCTCAGAAA No data
Right 1085859650 11:80216769-80216791 TTCCAGGCAAGCAAAAATGGAGG No data
1085859646_1085859650 5 Left 1085859646 11:80216741-80216763 CCCTCAGAAATGAAGGAGAAATA 0: 39
1: 229
2: 839
3: 1388
4: 2020
Right 1085859650 11:80216769-80216791 TTCCAGGCAAGCAAAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085859650 Original CRISPR TTCCAGGCAAGCAAAAATGG AGG Intergenic
No off target data available for this crispr